ID: 1110007662

View in Genome Browser
Species Human (GRCh38)
Location 13:70293249-70293271
Sequence CAAAATGTTGATGGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110007658_1110007662 -6 Left 1110007658 13:70293232-70293254 CCTTGAATAGCTTTGACCAAAAT No data
Right 1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110007662 Original CRISPR CAAAATGTTGATGGTGATAT GGG Intergenic
No off target data available for this crispr