ID: 1110011932

View in Genome Browser
Species Human (GRCh38)
Location 13:70347060-70347082
Sequence ATGTGGGAAGGTAAAAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110011928_1110011932 17 Left 1110011928 13:70347020-70347042 CCAGGCACAGAAAGACAGGGTAT No data
Right 1110011932 13:70347060-70347082 ATGTGGGAAGGTAAAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110011932 Original CRISPR ATGTGGGAAGGTAAAAAAGT TGG Intergenic
No off target data available for this crispr