ID: 1110025540

View in Genome Browser
Species Human (GRCh38)
Location 13:70534017-70534039
Sequence GTGTAAACTCACTAATATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110025540_1110025543 24 Left 1110025540 13:70534017-70534039 CCCATATATTAGTGAGTTTACAC No data
Right 1110025543 13:70534064-70534086 TTTACTTGTTAATTTTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110025540 Original CRISPR GTGTAAACTCACTAATATAT GGG (reversed) Intergenic
No off target data available for this crispr