ID: 1110050158

View in Genome Browser
Species Human (GRCh38)
Location 13:70886918-70886940
Sequence ATGTCCTTTTAATAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110050158_1110050162 18 Left 1110050158 13:70886918-70886940 CCTTCATTCTATTAAAAGGACAT No data
Right 1110050162 13:70886959-70886981 TCCATGGTTTACAATAAAAGAGG No data
1110050158_1110050160 2 Left 1110050158 13:70886918-70886940 CCTTCATTCTATTAAAAGGACAT No data
Right 1110050160 13:70886943-70886965 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110050158 Original CRISPR ATGTCCTTTTAATAGAATGA AGG (reversed) Intergenic
No off target data available for this crispr