ID: 1110050162

View in Genome Browser
Species Human (GRCh38)
Location 13:70886959-70886981
Sequence TCCATGGTTTACAATAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110050158_1110050162 18 Left 1110050158 13:70886918-70886940 CCTTCATTCTATTAAAAGGACAT No data
Right 1110050162 13:70886959-70886981 TCCATGGTTTACAATAAAAGAGG No data
1110050156_1110050162 26 Left 1110050156 13:70886910-70886932 CCAGGAGGCCTTCATTCTATTAA No data
Right 1110050162 13:70886959-70886981 TCCATGGTTTACAATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110050162 Original CRISPR TCCATGGTTTACAATAAAAG AGG Intergenic
No off target data available for this crispr