ID: 1110054134

View in Genome Browser
Species Human (GRCh38)
Location 13:70943025-70943047
Sequence CTGTAAATATGTAAGACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110054128_1110054134 -4 Left 1110054128 13:70943006-70943028 CCTTACCCCTTAGGCTAACCTGT No data
Right 1110054134 13:70943025-70943047 CTGTAAATATGTAAGACAGTGGG No data
1110054129_1110054134 -9 Left 1110054129 13:70943011-70943033 CCCCTTAGGCTAACCTGTAAATA No data
Right 1110054134 13:70943025-70943047 CTGTAAATATGTAAGACAGTGGG No data
1110054130_1110054134 -10 Left 1110054130 13:70943012-70943034 CCCTTAGGCTAACCTGTAAATAT No data
Right 1110054134 13:70943025-70943047 CTGTAAATATGTAAGACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110054134 Original CRISPR CTGTAAATATGTAAGACAGT GGG Intergenic
No off target data available for this crispr