ID: 1110060438

View in Genome Browser
Species Human (GRCh38)
Location 13:71032918-71032940
Sequence GCCTGACCTCCCCTGTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110060438_1110060447 17 Left 1110060438 13:71032918-71032940 CCTGACAACAGGGGAGGTCAGGC No data
Right 1110060447 13:71032958-71032980 GGATAGGGACCAAATCCACAGGG No data
1110060438_1110060446 16 Left 1110060438 13:71032918-71032940 CCTGACAACAGGGGAGGTCAGGC No data
Right 1110060446 13:71032957-71032979 AGGATAGGGACCAAATCCACAGG No data
1110060438_1110060441 1 Left 1110060438 13:71032918-71032940 CCTGACAACAGGGGAGGTCAGGC No data
Right 1110060441 13:71032942-71032964 CCCTCTCACACCCTTAGGATAGG No data
1110060438_1110060443 2 Left 1110060438 13:71032918-71032940 CCTGACAACAGGGGAGGTCAGGC No data
Right 1110060443 13:71032943-71032965 CCTCTCACACCCTTAGGATAGGG No data
1110060438_1110060439 -4 Left 1110060438 13:71032918-71032940 CCTGACAACAGGGGAGGTCAGGC No data
Right 1110060439 13:71032937-71032959 AGGCTCCCTCTCACACCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110060438 Original CRISPR GCCTGACCTCCCCTGTTGTC AGG (reversed) Intergenic
No off target data available for this crispr