ID: 1110068303

View in Genome Browser
Species Human (GRCh38)
Location 13:71138539-71138561
Sequence CACAGCTATCATACTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110068302_1110068303 22 Left 1110068302 13:71138494-71138516 CCTGTGAGATAAAAGGTGGTCAT No data
Right 1110068303 13:71138539-71138561 CACAGCTATCATACTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110068303 Original CRISPR CACAGCTATCATACTGCACC TGG Intergenic
No off target data available for this crispr