ID: 1110071731

View in Genome Browser
Species Human (GRCh38)
Location 13:71186193-71186215
Sequence TACCATTCACAACATAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110071729_1110071731 -2 Left 1110071729 13:71186172-71186194 CCTAGAAGAAAACCTATGCAATA 0: 37
1: 8799
2: 11257
3: 4838
4: 3132
Right 1110071731 13:71186193-71186215 TACCATTCACAACATAAGCATGG No data
1110071727_1110071731 8 Left 1110071727 13:71186162-71186184 CCGTAAAAACCCTAGAAGAAAAC 0: 13907
1: 6005
2: 2254
3: 1484
4: 1824
Right 1110071731 13:71186193-71186215 TACCATTCACAACATAAGCATGG No data
1110071728_1110071731 -1 Left 1110071728 13:71186171-71186193 CCCTAGAAGAAAACCTATGCAAT 0: 38
1: 8517
2: 10621
3: 3903
4: 2125
Right 1110071731 13:71186193-71186215 TACCATTCACAACATAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110071731 Original CRISPR TACCATTCACAACATAAGCA TGG Intergenic
No off target data available for this crispr