ID: 1110077818

View in Genome Browser
Species Human (GRCh38)
Location 13:71271535-71271557
Sequence CCCAGATTGTCCCAAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110077818_1110077820 28 Left 1110077818 13:71271535-71271557 CCAGCAGTTTGGGACAATCTGGG No data
Right 1110077820 13:71271586-71271608 CAAATTTATTTTTATTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110077818 Original CRISPR CCCAGATTGTCCCAAACTGC TGG (reversed) Intergenic