ID: 1110079046

View in Genome Browser
Species Human (GRCh38)
Location 13:71287473-71287495
Sequence AGAGAAAGCGCAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110079046_1110079051 13 Left 1110079046 13:71287473-71287495 CCCACAGTCACTGCGCTTTCTCT No data
Right 1110079051 13:71287509-71287531 GACATTCTCTTTGTACCATGTGG No data
1110079046_1110079052 26 Left 1110079046 13:71287473-71287495 CCCACAGTCACTGCGCTTTCTCT No data
Right 1110079052 13:71287522-71287544 TACCATGTGGCCAATGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110079046 Original CRISPR AGAGAAAGCGCAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr