ID: 1110092430

View in Genome Browser
Species Human (GRCh38)
Location 13:71470418-71470440
Sequence CAGGAGAATCAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 1, 2: 2, 3: 100, 4: 607}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110092430_1110092434 -1 Left 1110092430 13:71470418-71470440 CCTGCCTCAGCCTGATTCTCCTG 0: 1
1: 1
2: 2
3: 100
4: 607
Right 1110092434 13:71470440-71470462 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1110092430_1110092439 27 Left 1110092430 13:71470418-71470440 CCTGCCTCAGCCTGATTCTCCTG 0: 1
1: 1
2: 2
3: 100
4: 607
Right 1110092439 13:71470468-71470490 CAGACACTTGCCACCATGCCCGG 0: 9
1: 409
2: 8123
3: 31581
4: 81027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110092430 Original CRISPR CAGGAGAATCAGGCTGAGGC AGG (reversed) Intronic
900509217 1:3050529-3050551 CAGGAGAATGAAGATGGGGCAGG + Intergenic
900565418 1:3329572-3329594 CAGGAAAACCAGGCAGAGGAAGG + Intronic
900674735 1:3878006-3878028 CAGGAGGTTCAAGCTGCGGCTGG - Intronic
901407193 1:9057172-9057194 CAGGATCAGGAGGCTGAGGCAGG + Intronic
901922266 1:12545855-12545877 CGGGAGGCTGAGGCTGAGGCAGG - Intergenic
902518112 1:17000584-17000606 CAGGAGACCCAGCCTGTGGCTGG - Intronic
902519764 1:17009620-17009642 TAGGAGGATCAGCATGAGGCCGG - Intronic
902687520 1:18088308-18088330 AATGAGAAAGAGGCTGAGGCAGG + Intergenic
902745340 1:18470047-18470069 CAGGAGAGACAGGCTGTGGGAGG - Intergenic
902754324 1:18539263-18539285 CTGTGGGATCAGGCTGAGGCTGG + Intergenic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903472157 1:23594813-23594835 CAGCATACTCTGGCTGAGGCAGG + Intronic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
903610164 1:24605603-24605625 CAGGAAAATGAGGACGAGGCGGG + Exonic
903847141 1:26285311-26285333 CAGGAGGATAAGTCTGAAGCCGG - Intronic
903847562 1:26287545-26287567 CAGGACAAGCAGGCTGCGGCAGG + Intronic
904014610 1:27409944-27409966 CAGCAAAATCAGGGTGAGGTGGG + Exonic
904379675 1:30102245-30102267 CACAAGAAGCAGGCTGGGGCCGG - Intergenic
904620155 1:31770384-31770406 AAGGAGGACCAGGCCGAGGCAGG - Intergenic
904899869 1:33848412-33848434 CAGGAGAATCAGTGGGAGACTGG - Intronic
905164243 1:36067575-36067597 CAGGCGCCTGAGGCTGAGGCAGG + Exonic
905343534 1:37295628-37295650 CAGGAGAGTCAGGATGAGTACGG + Intergenic
905645488 1:39622433-39622455 CAGGAGCATCATGCAGAGTCTGG - Intergenic
905702199 1:40025952-40025974 CAAGAGATTGAGGCTGAGGACGG + Intergenic
905823905 1:41015181-41015203 CAGGAGAAACGGCCAGAGGCAGG + Intergenic
905845334 1:41225979-41226001 CAGGAGGTTCAAGGTGAGGCAGG - Intronic
906454474 1:45981950-45981972 CGGGAGGCTGAGGCTGAGGCAGG - Intronic
907331833 1:53676646-53676668 AAGGACAATCAGGCTGAAACAGG + Intronic
907439887 1:54472632-54472654 CAGCAGAAGCTGGCTGTGGCTGG + Intergenic
907854926 1:58293579-58293601 CAGGAGAATCTGGCATGGGCAGG + Intronic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
910946690 1:92600476-92600498 AAGGGGAAACAGGCTGGGGCTGG + Intronic
911289930 1:96045164-96045186 CAGCCGGATCAGGCTGAGGTGGG - Intergenic
912372921 1:109187585-109187607 CAGGAGACCCCGGCTGAGTCAGG - Intronic
912548816 1:110471065-110471087 CAGGAGGCTGAGGCTGAGGGAGG - Intergenic
912581092 1:110721616-110721638 CAGGAAAATTAAGTTGAGGCAGG - Intergenic
913145398 1:115984640-115984662 CCGAAGAATCTGCCTGAGGCTGG - Intronic
913203818 1:116517396-116517418 CAGGAGAAACAAGCTGTGGCAGG - Intronic
913268376 1:117067429-117067451 CAGGAGAATCACTTTGAGCCGGG + Intronic
915137050 1:153739904-153739926 CAGGAGGAGGAGACTGAGGCAGG - Intronic
915662501 1:157415878-157415900 AAGGAGAGTCAGACGGAGGCAGG - Intergenic
916052973 1:161049024-161049046 GAGGACAAGCAGGCTGAGCCTGG - Exonic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916826651 1:168448297-168448319 CAGGAGACTGAGGCTGAGAGAGG - Intergenic
917552913 1:176054252-176054274 CAGGAGAATCAGTTTGAACCTGG - Intronic
917848579 1:179041512-179041534 CAGGTGTGGCAGGCTGAGGCAGG + Intronic
917955065 1:180087425-180087447 CTGGAGAATGATGCTGAGGGGGG + Intronic
918424406 1:184393400-184393422 CCTGAGAAACAGGCAGAGGCAGG - Intronic
918495785 1:185134295-185134317 CAGGAGGCTGAGGCTGAGACAGG - Intronic
919407527 1:197203429-197203451 CGGGAGGCTGAGGCTGAGGCAGG - Intergenic
919987963 1:202689051-202689073 CAGGAGATTCAGTCTGGGGGCGG - Intronic
920106595 1:203557629-203557651 CTGGAAATTCAGGCAGAGGCCGG + Intergenic
921319795 1:213927644-213927666 CAGGAGATACAGGCTCAGGGAGG - Intergenic
922229376 1:223672489-223672511 CAGGAGATTGAGGCTGTAGCGGG + Intergenic
922289292 1:224197305-224197327 CAGGAGAATTAGGATGTGGCTGG + Intergenic
922718015 1:227887043-227887065 CAGGAACATCTGGCTGAGACCGG + Intergenic
923155269 1:231272861-231272883 CAGGAGGCTGAGGCTGAGGCAGG + Intronic
924052340 1:240091998-240092020 CGGGAGAGTCAGGCGGCGGCGGG - Exonic
924808673 1:247382094-247382116 CAGGAGAATCTGCTTGAGCCTGG + Intergenic
1063747393 10:8899890-8899912 CAGCAGAATCAGGCTGGGCGCGG - Intergenic
1064549666 10:16486489-16486511 CAGGACAACCAAGCTGAGCCTGG - Exonic
1064582094 10:16805093-16805115 CGGGAGGCTGAGGCTGAGGCAGG + Intronic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1065469819 10:26066008-26066030 CGGGAGGCTGAGGCTGAGGCAGG + Intronic
1065817286 10:29493686-29493708 ACGTAGAATGAGGCTGAGGCTGG - Intronic
1065955567 10:30690791-30690813 ATGTAGAATGAGGCTGAGGCTGG + Intergenic
1066394010 10:35001435-35001457 CTGGAGGCTGAGGCTGAGGCAGG + Intergenic
1066516400 10:36165705-36165727 AATGAAAATTAGGCTGAGGCAGG + Intergenic
1066594365 10:37033323-37033345 TAGTAGAATCTGGCAGAGGCTGG + Intergenic
1067162795 10:43841794-43841816 CAGCTCAATCAGGCTGAGGCTGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067471332 10:46540831-46540853 CGGGAGGCTGAGGCTGAGGCAGG + Intergenic
1067564975 10:47329984-47330006 CAGGAGCATCAGGCGGGGGTGGG - Intergenic
1067746451 10:48940053-48940075 CAAGAGCAGCAGGCTGTGGCAGG + Intronic
1068161085 10:53264947-53264969 CAGGGGAATCAGTCAGAGGGAGG - Intergenic
1068860783 10:61845830-61845852 CAGGATGATCTGGCTGAGGCAGG + Intergenic
1069707747 10:70469282-70469304 CTGGAGATTCTGGCTGAGGAGGG + Intergenic
1069948504 10:72003366-72003388 CAGGAAAATTAGGAAGAGGCAGG + Intronic
1070042894 10:72799218-72799240 AAAAAGAATCAGGTTGAGGCCGG - Intronic
1070166335 10:73900956-73900978 CTGGAGATGGAGGCTGAGGCAGG + Intergenic
1070282561 10:75060362-75060384 CAGGAGGCTGAGGCTGAGGTGGG + Intergenic
1070919477 10:80175172-80175194 CAGAAGGGTCAGGCTGGGGCCGG - Intronic
1072456413 10:95580198-95580220 CTGAGGAATCAGGCTGAGGCTGG - Intergenic
1072671924 10:97436731-97436753 AAGGAGAATCAGGCTGGGCGTGG + Intronic
1072675741 10:97464789-97464811 CAGGAGAATCACTTTGAGCCCGG - Intronic
1072931112 10:99663531-99663553 CAGGAGATTGAGGCTGCAGCGGG - Intronic
1072944364 10:99796589-99796611 CAGGAGAATCACTTTGAAGCCGG + Intronic
1072950223 10:99840615-99840637 CAGGAGGCTGAGGCTGAGGCAGG - Intronic
1073018470 10:100420978-100421000 CGGGAGGGTGAGGCTGAGGCAGG + Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074909040 10:117890603-117890625 CAGGCGGCTGAGGCTGAGGCCGG + Intergenic
1075111096 10:119585194-119585216 TAGGAGGATGAGGCAGAGGCAGG + Intronic
1075115574 10:119623843-119623865 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076038304 10:127220294-127220316 CAGGAGAATGAAGAGGAGGCAGG + Intronic
1076706898 10:132307341-132307363 CAGGAGGAGCAGGCTGGGCCCGG - Intronic
1076841637 10:133048855-133048877 CAGGAGCATCCGGCTGAGGGAGG - Intergenic
1076995750 11:296787-296809 CAGGAGCCTGAGCCTGAGGCAGG + Intergenic
1078032974 11:7772183-7772205 CAGGACAATCAAGCTTAAGCTGG - Intergenic
1078225194 11:9385087-9385109 CATGAGGAGCCGGCTGAGGCGGG + Intronic
1078354345 11:10623150-10623172 CAGGAGAATGGGGCCGAGGAAGG + Intronic
1078567672 11:12430996-12431018 AAGGAAAATAAGGCTGAGGGTGG - Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079945096 11:26732135-26732157 CAGGAGGCTGAGGCAGAGGCAGG + Intergenic
1080358038 11:31474609-31474631 CAGGAGGTTAAGGCTGAGGTGGG + Intronic
1080692676 11:34571489-34571511 CAGGAGGCTGAGGCAGAGGCAGG + Intergenic
1081494231 11:43590614-43590636 CAGGAGGCTAAGGCTAAGGCAGG - Intronic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081606134 11:44528181-44528203 GGGGAGGATCAGGCTGGGGCTGG - Intergenic
1081767103 11:45619009-45619031 CAGGAGAAGCAAGCTCAGGTAGG + Intergenic
1081852814 11:46285463-46285485 CAGGAGAAGCTGGGAGAGGCAGG + Intronic
1081865127 11:46355532-46355554 CAGGAAACTGAGGCTGAGGCAGG + Intronic
1082173123 11:49030242-49030264 CAGGAGAATCACTCTGAACCTGG + Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082858437 11:57830071-57830093 GATGAGAATCAGGTTGAGCCAGG - Intergenic
1083038580 11:59664683-59664705 TAGGAGGTTGAGGCTGAGGCTGG - Intronic
1083663262 11:64261870-64261892 CAGGAGCACCTGGCTGAGGCCGG + Intronic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1084062492 11:66685513-66685535 CAGGAGAATGACCCTGAGGCAGG + Exonic
1084211764 11:67627619-67627641 CAGGAGGTGCAGGCTGAGACAGG + Intergenic
1084956681 11:72695335-72695357 CTAGAGAATCAGGCTGGGCCAGG - Intronic
1085061549 11:73452058-73452080 CAGGAGAACCAAGCCCAGGCTGG + Intronic
1085312528 11:75525112-75525134 CAGGGGAAACAAGCAGAGGCTGG - Intronic
1085879695 11:80451784-80451806 CAGGAGAAACAGGTTTAAGCTGG - Intergenic
1086005211 11:82028648-82028670 CAAGAGAATTAGGCTGAGATAGG - Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086331837 11:85761992-85762014 GAGGAGAGTGAGGCTGAGGGGGG + Intronic
1086488276 11:87331891-87331913 CAGGAGGCTGAGGCTGAGGCAGG + Intergenic
1086825414 11:91489799-91489821 AAGGACCATCAGGTTGAGGCAGG + Intergenic
1087784422 11:102338863-102338885 AGGGAGAATGAGGCTGAGACAGG + Intronic
1087993416 11:104774078-104774100 AAGGAAAGTAAGGCTGAGGCCGG - Intergenic
1088505489 11:110522945-110522967 CAGGAGAATCAGCTTGAACCTGG - Intergenic
1089304471 11:117517903-117517925 CAAGAGTAAGAGGCTGAGGCTGG - Intronic
1089307360 11:117535141-117535163 AAGGTGATGCAGGCTGAGGCTGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1090456838 11:126857457-126857479 CAGCAGGATCAAGCTGAGACTGG + Intronic
1090926145 11:131252012-131252034 CAAGAGAAACAGGGTGAGGCAGG - Intergenic
1090978603 11:131696595-131696617 CATGAGAATCAGGCTCAGAGAGG - Intronic
1091439406 12:500977-500999 CAGGAGGCTGAGGCTGAGGCAGG - Intronic
1091456551 12:612400-612422 CAGGAATATCTGGCTCAGGCTGG + Intronic
1091580431 12:1784361-1784383 CAGGAGACTAAGGCTTAGGGAGG + Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1093834306 12:23807751-23807773 CAGGATGCTGAGGCTGAGGCAGG - Intronic
1094610442 12:31990557-31990579 CAGGAGGCTGAGGCCGAGGCAGG - Intronic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1095307281 12:40653010-40653032 TAGGAGAAGCAGGTTGGGGCAGG - Intergenic
1095452984 12:42350869-42350891 CAGGAGAATCAGGCAGGGAGAGG + Intronic
1096434097 12:51573576-51573598 CAGGAGCTTCACTCTGAGGCAGG + Intergenic
1096786731 12:54021210-54021232 CAGGCAAATCGGGCTGGGGCGGG - Intronic
1097058256 12:56263646-56263668 CAGGAGGCTGAGGTTGAGGCAGG - Intergenic
1097081262 12:56432841-56432863 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
1097273341 12:57793326-57793348 CGGGAGGCTGAGGCTGAGGCAGG - Intronic
1097813652 12:64046651-64046673 GGGGAGAAGCAGGCTGAAGCGGG + Intronic
1097925957 12:65126595-65126617 CAGGAGAAACCGACTGAAGCAGG - Intergenic
1097942181 12:65322547-65322569 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
1099293586 12:80802744-80802766 CAGGAGGAGGAGGGTGAGGCAGG - Intronic
1099589752 12:84572117-84572139 CGGGAGGCTGAGGCTGAGGCAGG + Intergenic
1100138201 12:91582187-91582209 CAGGAGGCTGAGGCTGAGGCAGG + Intergenic
1100473677 12:94916315-94916337 TAGGAAAATGAGGCTGAGACTGG - Intronic
1100486403 12:95032344-95032366 CAGCACAAGGAGGCTGAGGCAGG + Intronic
1100659498 12:96681675-96681697 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1101044485 12:100790582-100790604 AGGGAGAATTAGGCTGAGTCTGG - Intronic
1101816091 12:108147281-108147303 CAAGAGAAGCAGGGTCAGGCGGG + Intronic
1102142641 12:110628257-110628279 TAGAAGAAGCAGGCTGAGTCTGG + Intronic
1102579910 12:113879768-113879790 CAGGAGACTTAGGCTAAGGAGGG - Intronic
1102599400 12:114017763-114017785 CTGCAGGATCAGGCTCAGGCTGG + Intergenic
1102865938 12:116374009-116374031 CAGGAGAAGCGGACTGAGCCAGG + Intergenic
1103589281 12:121979860-121979882 CCAAAGAATAAGGCTGAGGCCGG - Intronic
1103874338 12:124115701-124115723 CAGGAGACAGAGGCTGGGGCTGG - Intronic
1104608294 12:130205752-130205774 CTGTAGAGTCAGGGTGAGGCCGG + Intergenic
1104769140 12:131349851-131349873 CAGAAGCATCAGGGTGAAGCCGG + Intergenic
1105303110 13:19152530-19152552 CAGGAGGCACAGGCTGAGCCTGG + Intergenic
1105404720 13:20123925-20123947 CAGGAGGCTGAGGCTGAGGCAGG - Intergenic
1105671263 13:22618957-22618979 CGGGAGACTGAGGCTGAGGCAGG + Intergenic
1105839022 13:24237249-24237271 CAGGAGGTGGAGGCTGAGGCAGG + Intronic
1106176673 13:27337862-27337884 CAGGAGAAACAGCCTGTGGCTGG + Intergenic
1108756117 13:53504435-53504457 CTGTGGGATCAGGCTGAGGCTGG + Intergenic
1109606329 13:64702859-64702881 CAGGAGGCAGAGGCTGAGGCAGG - Intergenic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1110574199 13:77037369-77037391 CAGGAGAAACAGACTGAGTGGGG - Intergenic
1110615900 13:77542154-77542176 AACCAGAATCAGGCCGAGGCAGG + Intronic
1110848440 13:80217059-80217081 CGGGAGGCTGAGGCTGAGGCAGG - Intergenic
1112382302 13:98903486-98903508 CGGGAGGCTGAGGCTGAGGCAGG + Intronic
1112422917 13:99269123-99269145 GAGGATACTCAGGCTGTGGCTGG + Intronic
1113694813 13:112337295-112337317 GAGGAGAATGAGGACGAGGCTGG + Intergenic
1113885741 13:113657540-113657562 CAGGTGCTGCAGGCTGAGGCAGG + Intronic
1114823606 14:26051339-26051361 CAGGAGGCTGAGACTGAGGCAGG + Intergenic
1115517240 14:34198195-34198217 CAGGAGCATCTGTCTGAGTCTGG + Intronic
1116421294 14:44735779-44735801 AAGGAGAATCAGGCTGACCTTGG - Intergenic
1116823263 14:49646426-49646448 CAGGAGAAGGAGGCTAAGGCAGG - Intronic
1117062476 14:51977316-51977338 CAGGAAGATCGGGCTGAGGCGGG + Intronic
1117273071 14:54164682-54164704 CTGGAGAATAACTCTGAGGCTGG - Intergenic
1118167557 14:63352810-63352832 CAGGAGAATCACCTTGAGCCTGG - Intergenic
1118943269 14:70358825-70358847 CATGAAATGCAGGCTGAGGCTGG - Intronic
1119422940 14:74518360-74518382 GATGAGAAGCAGGCTGGGGCCGG - Intronic
1119498470 14:75101813-75101835 AAGGAAAATCAGGCTGAGAATGG + Intronic
1120878714 14:89397999-89398021 CAGGATAGTCAGACTGGGGCTGG - Intronic
1121219472 14:92274922-92274944 CAGGAGAAGGAAGGTGAGGCGGG - Intergenic
1121310184 14:92931591-92931613 GAGGAGGAGGAGGCTGAGGCTGG + Exonic
1121467015 14:94122384-94122406 CAAGAGAGTTTGGCTGAGGCTGG - Intergenic
1121636997 14:95460800-95460822 CAGGAGTAACAGACAGAGGCTGG + Intronic
1122229716 14:100299716-100299738 CAGGAGAAACAGGCTCAGTGAGG + Intronic
1122288908 14:100668955-100668977 AAGGACAAGTAGGCTGAGGCTGG - Intergenic
1122576528 14:102746598-102746620 CAGGGGAAGCAGGCTGAGCCAGG + Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122964120 14:105113185-105113207 CAGGAGGCTGAGGCTGAGGCAGG - Intergenic
1123997880 15:25731563-25731585 CAGCAGGGTCAGGCTGAGCCAGG + Intronic
1124057477 15:26255354-26255376 AAGAAGAGGCAGGCTGAGGCAGG - Intergenic
1124170232 15:27366561-27366583 CAGCAGAACAGGGCTGAGGCTGG - Intronic
1124215971 15:27807276-27807298 CAGGAGAGTGGGGGTGAGGCTGG - Intronic
1124220991 15:27849440-27849462 CAGGAAACTCAGGCAAAGGCAGG + Intronic
1124426032 15:29563723-29563745 CAGGAGGCTGAGGCTGAGGCAGG + Intronic
1125028233 15:35051886-35051908 CAGGAGGCTGAGGCTGAGGCAGG - Intergenic
1125592202 15:40861822-40861844 CTGGAGGCTGAGGCTGAGGCAGG - Intergenic
1125728372 15:41879663-41879685 CAGGTGAGTCAGGCCCAGGCTGG + Intronic
1126592161 15:50351468-50351490 CAGGAGGCTGAGGCAGAGGCAGG + Intronic
1126950902 15:53879829-53879851 AAAGAGAATCAGGCCAAGGCAGG - Intergenic
1127078102 15:55348098-55348120 CAGCTGAGGCAGGCTGAGGCAGG - Intronic
1128335023 15:66780258-66780280 CAGGAGGCTAAGGCTGAGTCAGG + Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128785272 15:70391729-70391751 CAGGAGAATCAGCCTGAACCAGG + Intergenic
1129007910 15:72389848-72389870 CAGGAGAATGAAGCAGATGCAGG - Intergenic
1129170981 15:73807647-73807669 CAGCAGAAGCCAGCTGAGGCAGG - Intergenic
1129326935 15:74805139-74805161 CAGGAGACTCATGCTTAGGAGGG + Intergenic
1129854469 15:78813437-78813459 CAGGAGATTGAGGCTGGGCCAGG + Intronic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1130561706 15:84964082-84964104 CAGGAGAATCAGGGTGCTGTGGG - Intergenic
1130902212 15:88215547-88215569 CAGGGGAGCCAGGCTGGGGCTGG + Intronic
1131061330 15:89406443-89406465 CAGGAGACTCAGGCTGTAACCGG + Intergenic
1131495549 15:92907431-92907453 CAGAAGCATCCGGCTAAGGCAGG + Intronic
1131541780 15:93280602-93280624 GAGGAGACCCAGGCAGAGGCAGG - Intergenic
1131994902 15:98124382-98124404 CAGGATTATCAGGCTGAAGCAGG - Intergenic
1132092976 15:98960609-98960631 CAGGAGGCTCGCGCTGAGGCAGG + Exonic
1132722201 16:1321907-1321929 CAGGGGAGCCAGGCTGAGCCTGG - Intronic
1132826360 16:1907541-1907563 CTGGAGGGTCAGGGTGAGGCGGG - Intergenic
1132991410 16:2797373-2797395 CGGGAGGCTGAGGCTGAGGCAGG - Intergenic
1133217317 16:4300587-4300609 CGGGAGGCTGAGGCTGAGGCAGG + Intergenic
1133302548 16:4791626-4791648 CAGGAGGAGGAGGCTGTGGCAGG - Intronic
1133521778 16:6565348-6565370 CAGGAGAATCAGCTTGAATCTGG - Intronic
1134296328 16:12949280-12949302 CCGTGGAATCAGGCTGTGGCTGG - Intronic
1134324251 16:13192627-13192649 TAGAAGAAACAGGCCGAGGCGGG + Intronic
1134889327 16:17824942-17824964 CGGGAGGCTGAGGCTGAGGCAGG + Intergenic
1136595324 16:31245039-31245061 CAGGAGGCTGAGGCTGAGGCAGG - Intergenic
1136617520 16:31407693-31407715 AAGGAGATGCAGGCTGAGCCTGG - Intronic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137550768 16:49435979-49436001 CAGTAGATTTAGCCTGAGGCTGG - Intergenic
1137728161 16:50670732-50670754 CAGGAGGAGCTGGCTGTGGCAGG + Intronic
1138480348 16:57298641-57298663 CAGGAGGCTGAGGATGAGGCAGG + Intergenic
1138982042 16:62281380-62281402 CAGGAGAATCGGCTTGAGCCCGG - Intergenic
1139417146 16:66822112-66822134 CAGCAGAACCAGGCTGAGACAGG - Intronic
1139436998 16:66942076-66942098 CAGGTGGATCAGGAAGAGGCAGG - Intronic
1139904845 16:70357146-70357168 CAGGAGGCGGAGGCTGAGGCAGG + Intronic
1139914882 16:70421769-70421791 CAGGATGCTGAGGCTGAGGCAGG - Intronic
1140889426 16:79272365-79272387 CAAGAGTAACAGGCTCAGGCTGG + Intergenic
1141098948 16:81182865-81182887 AAGGTGAATGAGGCTGAGACAGG + Intergenic
1141099340 16:81185592-81185614 CAGCAGAGTCAGGCGGCGGCAGG + Intergenic
1141520520 16:84575792-84575814 GAGGAGACTCAGGCTCAGGGAGG - Intronic
1142001721 16:87668132-87668154 AAGGAGGAACAGGCTCAGGCAGG - Intronic
1142554358 17:763069-763091 CGGGAGGCTGAGGCTGAGGCAGG + Intronic
1142818412 17:2446719-2446741 GAGGCGTAGCAGGCTGAGGCAGG - Intronic
1142962526 17:3559545-3559567 CAGGGGACACAGGCTCAGGCAGG + Intergenic
1143057440 17:4172969-4172991 CCAGATACTCAGGCTGAGGCAGG - Intronic
1143161488 17:4874631-4874653 GAGGAGGATTAGGCAGAGGCTGG + Intronic
1144504586 17:15819264-15819286 CACAAAAATTAGGCTGAGGCTGG - Intergenic
1144558850 17:16305169-16305191 CAGGAGGCTGAGGCTGAGGTGGG + Intronic
1144574618 17:16421320-16421342 CGGGAGGCTGAGGCTGAGGCAGG - Intronic
1144749073 17:17635712-17635734 CAGAAGGCTGAGGCTGAGGCAGG + Intergenic
1144874566 17:18390637-18390659 CAGTAGGATGAGGCTGGGGCTGG - Intergenic
1145246510 17:21273232-21273254 CAGTAGAAGGAGGCTGAGGGAGG - Intergenic
1145882151 17:28360185-28360207 CAGGAGGATCACCTTGAGGCTGG - Intronic
1145888298 17:28397611-28397633 CCTGAGAATCATTCTGAGGCTGG + Exonic
1146187837 17:30736887-30736909 AAAGAAAATGAGGCTGAGGCAGG - Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146885445 17:36467584-36467606 CAGGAGACTCAGGCTAGGGTGGG - Intergenic
1147112615 17:38274476-38274498 CAGGAGGCTGAGGCTGAGGCAGG + Intergenic
1148127568 17:45244805-45244827 CAGGACAATCTGGGAGAGGCAGG - Exonic
1148417013 17:47514762-47514784 CAGGAGGCTGAGGCTGAGGCAGG - Intergenic
1148777730 17:50105042-50105064 CAGGAGACTGAGGCTGAGATGGG - Intronic
1148911197 17:50944139-50944161 CAGGAGTCTCAGGCTGGGGAGGG - Intergenic
1149691854 17:58583716-58583738 CTGGAGAAGCAGGCCTAGGCAGG - Intronic
1149719123 17:58825660-58825682 CTAGAGAATCAGACTGAGGCTGG - Intronic
1149777551 17:59370166-59370188 CAGGAGGCTGAGGCTGAGGCTGG - Intronic
1149845370 17:60006436-60006458 CAGGAGCACCAGGCTGGGGGAGG - Intergenic
1150555329 17:66249037-66249059 CAGGAGAATCAGCTTGAAACCGG + Intronic
1151279261 17:73060114-73060136 CAGGAGAATTCGCCTGAAGCCGG + Intronic
1151582432 17:74987961-74987983 CGGGACAATGCGGCTGAGGCGGG - Exonic
1151748117 17:76022358-76022380 CTGGAGAAACGGGCTGGGGCTGG + Intronic
1151953092 17:77366029-77366051 CAGGAGAAACAGGCTGTCCCTGG - Intronic
1152104424 17:78320613-78320635 CGGGAGGCTGAGGCTGAGGCAGG - Intergenic
1152344529 17:79743086-79743108 CAGGCTCTTCAGGCTGAGGCAGG - Intergenic
1152518094 17:80837828-80837850 CAGGAGGAGCCGGCTGAGCCTGG - Intronic
1154486351 18:14874694-14874716 CAGCAGAATCAGGCAGAGCCTGG + Intergenic
1155238213 18:23842549-23842571 CTGTAGATTCAGCCTGAGGCAGG - Intronic
1155943682 18:31824797-31824819 TAGGAAAATGAGGCTGAGACTGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1157111741 18:44826832-44826854 CAGAAGGGCCAGGCTGAGGCTGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158933280 18:62341813-62341835 GAGGAGACTCAGGCTGAGAATGG + Intronic
1159024373 18:63169032-63169054 CAGGAGAGTCAGCCAGAGGCTGG - Intronic
1159110679 18:64052942-64052964 CAGGATAGTAAGGCAGAGGCTGG + Intergenic
1159245637 18:65800980-65801002 CAGGAAAACCAAGCTGAGCCCGG - Intronic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160787642 19:908694-908716 CAGGTGCATCAGGCAGAGACCGG - Intronic
1160829088 19:1094611-1094633 AAGAAGAATCAGGCTGCGGGGGG + Intronic
1161207984 19:3051808-3051830 CAGGAGGCTGAGGCTGAGGTGGG + Intergenic
1161340004 19:3736204-3736226 CAAGAGCATCGGGCTGCGGCTGG + Exonic
1161354515 19:3811339-3811361 GAGGAGCCTCAGGCTGATGCAGG - Exonic
1161448909 19:4333715-4333737 CCGGAGAATCAGGCTGAAGTGGG + Exonic
1161810904 19:6470864-6470886 CAGGAGTTTGAGGCTGAGGCGGG - Intronic
1162654897 19:12121210-12121232 CCAGACACTCAGGCTGAGGCAGG - Intronic
1162800251 19:13106172-13106194 CAGGAGCTTGAGGCGGAGGCAGG - Intronic
1163203166 19:15782583-15782605 CAGGGGATTCAGGCTGAAGGGGG + Intergenic
1163305895 19:16478665-16478687 CAGGTACTTCAGGCTGAGGCTGG - Intergenic
1163531482 19:17851966-17851988 AAGAAAAAGCAGGCTGAGGCAGG + Intergenic
1165002524 19:32776683-32776705 CAGGAGAGAGAGGCTGTGGCAGG + Intronic
1165323840 19:35102545-35102567 CAGGAGGCTGAGGCTGAGGTGGG + Intergenic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165363846 19:35352096-35352118 CAGGAGAGAGAGGCTGAAGCGGG - Exonic
1165520987 19:36313649-36313671 CAGGAGAATCACTCTGAACCTGG + Intergenic
1165623085 19:37264937-37264959 CAGGAGAATCACTCTGAACCTGG - Intergenic
1166187429 19:41150283-41150305 CAGGTGAGGGAGGCTGAGGCAGG - Intergenic
1166388804 19:42397404-42397426 GACGAGAATCAGGCTTAGGGTGG - Intergenic
1166661822 19:44652302-44652324 CAGGAGACTGAGGCTGAGGTGGG - Intronic
1166738369 19:45099455-45099477 GAGGAGACTCAGGCTCAGGGAGG - Intronic
1166861606 19:45814861-45814883 CATCAGAGTAAGGCTGAGGCTGG + Exonic
1167097659 19:47382993-47383015 AAAAAAAATCAGGCTGAGGCAGG + Intergenic
1167162292 19:47776101-47776123 CAGGGGGATCAGACTGAGGTGGG + Intergenic
1167988151 19:53335693-53335715 CAGTAGAATCAGTCTGAACCTGG - Intronic
1168209749 19:54881767-54881789 GAGGAGGATGAGGCTGAGGCAGG + Intronic
925047804 2:787883-787905 GAAGAGAAGCAGGTTGAGGCAGG + Intergenic
925295070 2:2770894-2770916 CTGTAGTCTCAGGCTGAGGCAGG - Intergenic
925469409 2:4142823-4142845 GAGAGGAAGCAGGCTGAGGCCGG - Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
925901784 2:8514069-8514091 CAGGAGACAGAGGGTGAGGCGGG + Intergenic
926028096 2:9562140-9562162 CAAGAGGCTGAGGCTGAGGCAGG + Intergenic
926242792 2:11101211-11101233 CATGGGAATCAGGTCGAGGCAGG - Intergenic
926358404 2:12062550-12062572 CAGGGGAACCTGGCAGAGGCAGG - Intergenic
926887024 2:17607170-17607192 AAGGAGAATGGGGCTGAGCCAGG + Intronic
927194669 2:20539267-20539289 CAGGAGATTAAGGCTGAGTGTGG + Intergenic
927475915 2:23414119-23414141 CAGAAGAAAGAGGCTGAGGAGGG + Intronic
928207945 2:29300441-29300463 CAGGAGGCTGAGGCTGAGGCAGG + Intronic
928309478 2:30197625-30197647 CTGGAGAAACTGGCTCAGGCAGG + Intergenic
928318604 2:30265655-30265677 AAGGAGACTGAGGCTCAGGCAGG - Intronic
929022445 2:37566892-37566914 CAGCAGGATCTGGATGAGGCAGG + Intergenic
929587752 2:43126938-43126960 CTGGGAAATCAGGCTGGGGCTGG - Intergenic
930029025 2:47047162-47047184 CAAGAGGATCAGGAAGAGGCAGG - Intronic
930469082 2:51791195-51791217 AGGGAGTCTCAGGCTGAGGCAGG - Intergenic
931079653 2:58754403-58754425 CAGGAGAACAGGGCTGAGACAGG + Intergenic
931293719 2:60901265-60901287 CCGGAGGCTGAGGCTGAGGCAGG - Intronic
931789814 2:65654745-65654767 TTGGAGAATCAGGCACAGGCTGG - Intergenic
932124154 2:69128129-69128151 CAGGAGAATCAGCCTGAACATGG + Intronic
932303201 2:70683127-70683149 CAGGAGGCTGAGGCTGAGGCAGG - Intronic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933898076 2:86829210-86829232 CAGGAGGCTGAGGCTAAGGCGGG - Intronic
933939810 2:87235754-87235776 CAGGAGAACCAGGCAGTGGACGG + Intergenic
934751579 2:96797387-96797409 CAGGAGCAGCAGGCTCTGGCTGG - Intronic
934903490 2:98179364-98179386 CACGAGAATGTGCCTGAGGCTGG + Intronic
936115356 2:109698104-109698126 CAGCACAAGGAGGCTGAGGCAGG - Intergenic
936353327 2:111730019-111730041 CAGGAGAACCAGGCAGTGGACGG - Intergenic
936716087 2:115189338-115189360 CAGGTGACTCAGGATGAGCCGGG + Intronic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937346687 2:121130416-121130438 CAGGGGAGCAAGGCTGAGGCAGG - Intergenic
937484506 2:122300621-122300643 CAGAACAATCAGTCTGAGGTGGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937888559 2:126917047-126917069 CCGTAGGAACAGGCTGAGGCTGG + Intergenic
938232935 2:129677617-129677639 TAGGAGAATGAGGGTGGGGCTGG - Intergenic
938695900 2:133835318-133835340 CTGTAGGATCAGGCTGAGGCTGG - Intergenic
940109221 2:150133057-150133079 CAGGAGGCTGAGGCTGAGGCAGG - Intergenic
940280703 2:151986775-151986797 TAGGAGAATCAGACTGGGCCAGG - Intronic
940752218 2:157639020-157639042 CAGGAGAATGAGCCTGGAGCAGG - Intergenic
940783125 2:157954198-157954220 CAGGAGACTGAGGTTGAGGTTGG + Intronic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
942605570 2:177686819-177686841 CAGGAGGCTGAGGCTGAGGCAGG - Intronic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
942942002 2:181630141-181630163 CAAGAGGGTGAGGCTGAGGCTGG - Intronic
943073803 2:183171865-183171887 CAGCAAATTCAGGCAGAGGCAGG + Intergenic
943634427 2:190289969-190289991 CAGGAGAATCAGCTTGAACCTGG - Intronic
944784432 2:203054060-203054082 CAGGAGGCTGAGGCTGAGGTGGG - Intronic
945965697 2:216184586-216184608 CAGGAGGCTGAGGCGGAGGCAGG - Intronic
946288826 2:218727628-218727650 CAGGAGGCTGAGGCTGAGGCAGG + Intronic
948011748 2:234654256-234654278 GAGGAGAAAAAGGCTGAGGGAGG + Intergenic
948260540 2:236601220-236601242 TGGGAGAACCAGGCAGAGGCTGG - Intergenic
948649627 2:239432803-239432825 CGGGAGGCTGAGGCTGAGGCAGG - Intergenic
948768807 2:240236868-240236890 TGGGAGTTTCAGGCTGAGGCTGG - Intergenic
948841309 2:240650805-240650827 CAGGAGCACCTGGCTGTGGCAGG - Intergenic
1168990935 20:2095234-2095256 CAGAATAGTAAGGCTGAGGCTGG - Intergenic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1169050514 20:2573065-2573087 CAGGAGGCTGAGGCTGAGGCTGG - Intronic
1169238912 20:3957901-3957923 GTGGAGAATCAGGCTGAGACTGG - Intronic
1169374937 20:5058749-5058771 CAGGAGGCTGAGGCTGAGGTGGG + Intergenic
1169510190 20:6255564-6255586 CTGTGGCATCAGGCTGAGGCTGG - Intergenic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1170844062 20:19947258-19947280 CAGGAAGCTGAGGCTGAGGCAGG + Intronic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1172251614 20:33483549-33483571 CAGGAGGACAAGGCAGAGGCAGG + Intergenic
1172603957 20:36202191-36202213 CAGGAGAATGATGCGGGGGCGGG - Intronic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1173511801 20:43635400-43635422 CAGGAGGCTGAGGCTGAGGCAGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173690497 20:44957296-44957318 CAGGAGGCTGAGGCTGAGGCAGG - Intronic
1174115085 20:48221279-48221301 CAGGAGAAGCAGCCTGTGCCAGG + Intergenic
1174237360 20:49104886-49104908 CAGGAAGATCAGCCTGAGCCTGG + Intergenic
1174346389 20:49933205-49933227 CAGCAGGAGGAGGCTGAGGCGGG - Intergenic
1174400754 20:50274639-50274661 CAGGAGATTGAGGCTGAAGTGGG + Intergenic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1175292771 20:57889195-57889217 CAGGAGAATCAGCTTGAACCCGG - Intergenic
1176191631 20:63813571-63813593 CAGTAGAACCAGGTAGAGGCGGG - Intronic
1176254128 20:64141705-64141727 CTTAAGAATAAGGCTGAGGCGGG + Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1176702966 21:10080461-10080483 TAGGTGAACCAGGCTCAGGCAGG + Intergenic
1176794951 21:13364686-13364708 CAGCAGAATCAGGCAGAGCCTGG - Intergenic
1176979633 21:15366186-15366208 CAGGTGACTCAGGATGAGTCAGG + Intergenic
1177012730 21:15748353-15748375 CAGGAGTTTGAGGCTGAAGCAGG - Intronic
1177917119 21:27102624-27102646 CAGGAGAATCAACCTGAACCTGG + Intergenic
1177953271 21:27565851-27565873 CTGGAGAACCAAGCTGAGGCTGG - Intergenic
1178422800 21:32455725-32455747 CAGGGGTATCTGGCAGAGGCAGG - Intronic
1178889677 21:36510591-36510613 CAAGAGAAACAGGCACAGGCAGG - Intronic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1180662890 22:17484299-17484321 CAGGATCAGGAGGCTGAGGCAGG - Intronic
1180902399 22:19384210-19384232 CAGGAGGCTGAGGCTGAGGCAGG + Intronic
1181008843 22:20028535-20028557 CAGGAGACTCAGCCTTAGGCTGG + Intronic
1181164825 22:20977591-20977613 CTGGAGGATCAGTCTGGGGCTGG + Intronic
1181585716 22:23852511-23852533 CAGGAGACTGAGGCTCAGGGAGG - Intergenic
1181851184 22:25751042-25751064 CAGGACACTCAGGCAGAGGGAGG - Intronic
1181919966 22:26312897-26312919 CAGGAGACCCAGGCTCAGGGTGG - Intronic
1182421021 22:30248628-30248650 CAGGAGAGCCAGGCTGAGTCAGG - Intergenic
1182802126 22:33040239-33040261 GTGTATAATCAGGCTGAGGCGGG - Intronic
1183257208 22:36770333-36770355 CAGGAGAACCAGGCCAGGGCAGG - Intronic
1183591117 22:38779833-38779855 AAGAAGAAACTGGCTGAGGCGGG + Intronic
1184062155 22:42090073-42090095 CGGGAGGCTGAGGCTGAGGCAGG + Intronic
1184601849 22:45548576-45548598 CAGGACACTGAGGCTGAGGTGGG + Intronic
1184858364 22:47158778-47158800 CAGGTGCCTCTGGCTGAGGCAGG - Intronic
1184960324 22:47923828-47923850 GAAGAGCATCAGGCTGTGGCAGG - Intergenic
1185001021 22:48245842-48245864 CAGCAGTAGGAGGCTGAGGCGGG + Intergenic
1185376870 22:50486689-50486711 CAGGAGTGTGAGGCTGAGTCAGG + Intergenic
950019996 3:9780326-9780348 CCAGATAATCAGCCTGAGGCAGG + Exonic
950098522 3:10343854-10343876 GAGGAGAATGGGGCTGAGGCAGG - Intronic
950146989 3:10657184-10657206 CAGGAGAAATATGATGAGGCTGG + Intronic
950221017 3:11196185-11196207 CTGGAGACTTAGGCAGAGGCTGG - Intronic
950377043 3:12580562-12580584 CGGGAGGCTGAGGCTGAGGCAGG - Intronic
950885970 3:16363036-16363058 CTGGAGCATTAGGCTGAGGTGGG - Intronic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
952183677 3:30945465-30945487 CAGTGGGATGAGGCTGAGGCTGG - Intergenic
952248445 3:31624243-31624265 CAGGAGCACAAGGCAGAGGCTGG - Intronic
952336370 3:32406788-32406810 CCATAGAATCAGGCTGAGGCTGG - Intronic
952893583 3:38061282-38061304 CAGGAGGCTGAGGCTGAAGCAGG - Intronic
952903362 3:38123893-38123915 CGGGAGGCTGAGGCTGAGGCAGG + Intronic
954080431 3:48210414-48210436 CAGGAGGCTGAGGCTGAGGCAGG + Intergenic
954211902 3:49102482-49102504 GACCAGAATCAGGCAGAGGCAGG + Intronic
955206116 3:56897670-56897692 CGGGAGGCTGAGGCTGAGGCAGG - Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956387367 3:68734400-68734422 CAGGAAAGAAAGGCTGAGGCAGG + Intronic
956444157 3:69309234-69309256 CAGGAGGCTGAGGCTGAGGTGGG - Intronic
957343501 3:78931350-78931372 CGGGAGGCTGAGGCTGAGGCAGG - Intronic
957651338 3:83009109-83009131 CAGGTGACTCAGGATGGGGCAGG + Intergenic
957680631 3:83428580-83428602 CAGCTGAGGCAGGCTGAGGCAGG + Intergenic
958085753 3:88804206-88804228 AATGAGAATCAGGCAGAGGGAGG + Intergenic
960513764 3:118580452-118580474 CATAGGAATCAGGCTGAGTCAGG + Intergenic
960686511 3:120299916-120299938 CAGGAGGCTGAGGCTAAGGCAGG - Intergenic
960739263 3:120814933-120814955 CAGAAGAGTGTGGCTGAGGCAGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961718988 3:128879654-128879676 GGGGAGACTGAGGCTGAGGCTGG + Exonic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962257143 3:133880300-133880322 TAGGAAAAGAAGGCTGAGGCAGG + Intronic
962444726 3:135454421-135454443 CAAGGGAATTAAGCTGAGGCTGG + Intergenic
963214416 3:142728422-142728444 CAGGAGGCTGAGGCTGAGGCCGG - Intronic
965726989 3:171728202-171728224 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
966871214 3:184291534-184291556 CTGGTGAATGGGGCTGAGGCTGG + Intronic
967159569 3:186723758-186723780 CAGGAGGCTGAGGCTGAGGCTGG - Intronic
967316876 3:188158060-188158082 CAGGAGAATAAGGCTGGGTAGGG + Intronic
968166554 3:196470528-196470550 GATGAGGATGAGGCTGAGGCTGG - Exonic
968166569 3:196470613-196470635 GACGAGGATGAGGCTGAGGCTGG - Exonic
968627536 4:1633960-1633982 CAGGGCAATGAGGCTGTGGCTGG + Intronic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
969412492 4:7038473-7038495 CAGGAGGCTGAGGCTGAGGTGGG - Intergenic
969457340 4:7307530-7307552 CAGCAGAGCCAGGCTGGGGCAGG + Intronic
969517266 4:7654668-7654690 CAGGAGAGCAGGGCTGAGGCAGG - Intronic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969651214 4:8469378-8469400 CAGAGGAAGAAGGCTGAGGCTGG + Intronic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
970202019 4:13619233-13619255 CAGGAGATTGAGGCTGCAGCAGG + Intronic
970674499 4:18433201-18433223 AAGTAGAATGAGGCTGAGACTGG + Intergenic
970777688 4:19695735-19695757 CAGGAGTATCGAGCTGAGGCAGG - Intergenic
970866937 4:20770092-20770114 CAGAAGAAGCAGGCTGTGGGAGG - Intronic
971331040 4:25681606-25681628 CAGGAGTATTGGGCAGAGGCGGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972169792 4:36332071-36332093 CAGGAGTTCAAGGCTGAGGCAGG + Intronic
972567664 4:40283861-40283883 CAGGAGAATCACGCTAACCCAGG - Intergenic
972680885 4:41305838-41305860 CTGGGGGATCAGGCTGAAGCTGG + Intergenic
974935809 4:68408717-68408739 CAGGAGGCTCAGGCTGAGGCAGG - Intergenic
975685433 4:76916189-76916211 GAGGCGTAGCAGGCTGAGGCAGG - Intergenic
977709728 4:100111250-100111272 CAGGAGGCTGAGGCTGAGGCAGG + Intergenic
979472539 4:121117655-121117677 AAGGAGCAGAAGGCTGAGGCAGG - Intergenic
980375160 4:131936835-131936857 TAGGTGAACCAGGCTCAGGCAGG + Intergenic
981080122 4:140631465-140631487 TAGGGGTTTCAGGCTGAGGCAGG - Intronic
982004054 4:151047936-151047958 CCAGATACTCAGGCTGAGGCAGG - Intergenic
984610414 4:181830567-181830589 CAGAAGAAGCAAGCTGGGGCAGG - Intergenic
984767970 4:183413999-183414021 CGGGAGAGTCAGGCGGCGGCAGG - Intergenic
984792251 4:183625642-183625664 CGGGAGGCTGAGGCTGAGGCAGG + Intergenic
984965367 4:185135310-185135332 CAGGAGGCTGAGGCTGAGGCAGG + Intergenic
985679954 5:1250634-1250656 CAGGAGCGTGGGGCTGAGGCAGG + Intergenic
985863823 5:2495719-2495741 CAGGAGACCCAGGCCAAGGCAGG + Intergenic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
986285308 5:6354524-6354546 CGGGAGAAGGAGGCAGAGGCTGG + Intergenic
988486420 5:31671651-31671673 CAGGAAACTCAGGCTCAGCCAGG - Intronic
988643161 5:33064275-33064297 CAGTAGAAGGAGGCTGAGGTGGG - Intergenic
989594812 5:43146481-43146503 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
990300577 5:54445606-54445628 CAGGAAAAGGAGGCTGACGCAGG + Intergenic
991726982 5:69545523-69545545 CGGGAGGCTGAGGCTGAGGCAGG + Intronic
991777110 5:70096035-70096057 CAGGAGAATCAGCTTGAACCTGG + Intergenic
991856396 5:70971479-70971501 CAGGAGAATCAGCTTGAACCTGG + Intronic
991867975 5:71082351-71082373 CGGGAGGCTGAGGCTGAGGCAGG - Intergenic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
992599813 5:78387962-78387984 GAGGAGGATCAGGCGGTGGCAGG + Intronic
992610486 5:78504321-78504343 CAGGAGAAAAATTCTGAGGCAGG + Intronic
992865638 5:80954454-80954476 CAGGAGAATCAGGAAGGGGCTGG + Intergenic
994192438 5:96883202-96883224 CCTGGGAATCAGGCTGATGCTGG + Intronic
994736890 5:103566681-103566703 CAGGAGAATGAGGCTGAGGCAGG + Intergenic
995192560 5:109333652-109333674 CAGGAGAATCACTCTGAAGGTGG + Intergenic
997358467 5:133279517-133279539 AAGGAGATGCAGGCTGAGTCTGG + Intronic
997989099 5:138529033-138529055 CAGGAGAATCGGCTTGAGCCTGG + Intronic
998529440 5:142871305-142871327 CAGGAGGATCAGGGAGTGGCTGG - Intronic
999186340 5:149712889-149712911 CAGAAAAATTAAGCTGAGGCTGG - Intergenic
999645325 5:153711960-153711982 CAGGAGAAGAAGTCTAAGGCGGG + Intronic
999671223 5:153960533-153960555 CAGGACAATCAGGCACACGCTGG - Intergenic
999972248 5:156876425-156876447 GAGAAGAATCAGGGTGGGGCTGG - Intergenic
1000201315 5:159013591-159013613 CCTGAGATCCAGGCTGAGGCTGG + Intronic
1000530078 5:162408774-162408796 CAGGCTACTCAGGCTGAGTCAGG - Intergenic
1000639641 5:163686313-163686335 CCGGAGAACCAAGCTGAGGAAGG + Intergenic
1001227110 5:169954531-169954553 CAGCAGAATCAGGCAGAGCCTGG + Intronic
1001309573 5:170601359-170601381 CAGGAGAAGGAGGCAGAAGCTGG + Intronic
1002071671 5:176682195-176682217 CAGGACAAGAAGGCTGGGGCAGG - Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003407961 6:5838928-5838950 CTGGAGAATGAGGATGGGGCGGG + Intergenic
1003954297 6:11147688-11147710 AAGGAAAATTAGGCTGAGGTGGG + Intergenic
1004425252 6:15502676-15502698 CATGAGATGCAGCCTGAGGCGGG - Intronic
1005250988 6:23945828-23945850 CAGGAGACTCAGTCTGTGCCTGG + Intergenic
1005364270 6:25061494-25061516 CTGTGGGATCAGGCTGAGGCTGG + Intergenic
1005809162 6:29503097-29503119 CAAGAGAAACAGGCAGATGCTGG - Intergenic
1006067199 6:31470637-31470659 CATGAGATTCAGGCAGAGGGAGG + Intergenic
1006383580 6:33715965-33715987 CAGGAGGCTGAGGCTGAAGCAGG - Intergenic
1006441952 6:34058585-34058607 GAGGGGATTCAGGGTGAGGCAGG + Intronic
1006536896 6:34706576-34706598 CAGGAGATTGAGGCTGCGGTGGG - Intergenic
1006599213 6:35214438-35214460 CAGGACAAGCAGGCAGAGCCCGG - Exonic
1006729903 6:36228989-36229011 GAGCAGAAACAGGCAGAGGCTGG + Exonic
1006766681 6:36512751-36512773 CAGGAGAATCAGCTTGAACCTGG - Intronic
1006815709 6:36848471-36848493 AAGGAGGCTGAGGCTGAGGCTGG - Intergenic
1007429849 6:41770557-41770579 CAGGAGTGTGAGGCAGAGGCTGG + Exonic
1007689946 6:43694362-43694384 CAGGAGGCTGAGGCTGAGGCAGG - Intergenic
1008480547 6:51981455-51981477 GAGGCGTAGCAGGCTGAGGCAGG - Intronic
1008923547 6:56867719-56867741 CGGGAGGCTGAGGCTGAGGCAGG + Intronic
1009398727 6:63230213-63230235 CAGGAGCAGCAGGGTGAGCCCGG + Intergenic
1010720651 6:79279739-79279761 CAGGAGCTGCAGGTTGAGGCCGG + Intergenic
1012762560 6:103320548-103320570 CGGGAGGCTGAGGCTGAGGCAGG + Intergenic
1013515990 6:110886409-110886431 CAGGAGGCTGAGGCTGAGGCAGG - Intronic
1013912965 6:115300004-115300026 CGGGAGGCTGAGGCTGAGGCAGG + Intergenic
1015218808 6:130780911-130780933 TAGGAGAATGAGGGTGTGGCGGG + Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017159863 6:151354781-151354803 CAGGAGACAGAGGCAGAGGCAGG - Intronic
1017361178 6:153573820-153573842 CGGGAGGCTGAGGCTGAGGCAGG - Intergenic
1017582289 6:155879286-155879308 CGGGAGGTTGAGGCTGAGGCAGG + Intergenic
1017761913 6:157575694-157575716 CAGGAGAATCCACCTGGGGCAGG - Intronic
1018036151 6:159883395-159883417 CAGGAGGCTGAGGCTGAGGCAGG + Intergenic
1018716474 6:166536644-166536666 CAGGAGGTCCAGGCTGGGGCTGG - Intronic
1019048829 6:169167932-169167954 CCTGAGAACCAGCCTGAGGCTGG - Intergenic
1019750231 7:2724583-2724605 CAGGAAATTCAGGCTGACGTGGG + Intronic
1020959077 7:14779429-14779451 CAGGAGGTTGAGGCTGAGGATGG + Intronic
1022300087 7:29094768-29094790 CAGGAGAACCAGGTTGAACCGGG + Intronic
1022530886 7:31066199-31066221 ATGGAGGATCAGGCTGAGGTGGG + Intronic
1022888341 7:34669455-34669477 CAGGAGGCTGAGGCTGAGGCAGG + Intronic
1023181678 7:37491313-37491335 TAGGAGGCTGAGGCTGAGGCAGG - Intergenic
1023250683 7:38257526-38257548 CAGGAGACTTAGGCTGGAGCAGG - Intergenic
1023473970 7:40556371-40556393 CCGCAGGATTAGGCTGAGGCAGG + Intronic
1023737976 7:43251419-43251441 CAGGAGGCTGAGGCTGAGGCTGG - Intronic
1023777795 7:43625788-43625810 CAGCAGAAACAGGCTGTGGTTGG - Exonic
1025988937 7:66480082-66480104 CAGGAGGCTGAGGCTGAGGAAGG + Intergenic
1026296671 7:69058980-69059002 GAGGAAAATGAGGCTGAGACAGG - Intergenic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026889073 7:73971711-73971733 CAGGGGATTCTGGCAGAGGCTGG - Intergenic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1030065155 7:105653752-105653774 CAGGAGAAGGTGGCTGGGGCAGG - Intronic
1030115343 7:106058594-106058616 CAGGAAAATCAGGCCCAGGCGGG + Intergenic
1030301417 7:107977906-107977928 TAGGAGTATCAGGGTGAAGCTGG + Intronic
1032283388 7:130523920-130523942 CGGGAGAGTCAGGTTGAGACTGG + Intronic
1032284130 7:130528145-130528167 CGGGAGAGTCAGGTTGAGACTGG + Intronic
1032284904 7:130532522-130532544 CAGGAGAGTCAGGTTGAGACTGG + Intronic
1032285700 7:130537057-130537079 CAGGAGAGTCAGGTTGAGACTGG + Intronic
1032286468 7:130541484-130541506 CAGGAGAGTCAGGTTGAGACTGG + Intronic
1033115420 7:138620597-138620619 CAGGTGAGCCAGGCTTAGGCTGG - Intronic
1033227079 7:139570859-139570881 CAGGAGAATCTGGCCAAGGATGG - Exonic
1033475566 7:141688800-141688822 CAGCAGAATCACCCTGTGGCAGG - Intronic
1033973185 7:147068449-147068471 CAGGAGAATCAGCTTGAACCTGG - Intronic
1034529962 7:151689548-151689570 CAGGAGAAGGCGGCAGAGGCGGG + Intronic
1034558729 7:151866210-151866232 CTGGACGGTCAGGCTGAGGCTGG - Intronic
1034588156 7:152114670-152114692 CGGGAGGCTGAGGCTGAGGCAGG - Intronic
1034843562 7:154422228-154422250 CAAGGAAATCAGGTTGAGGCTGG + Intronic
1035068391 7:156123997-156124019 CAGGACACACAGGCGGAGGCAGG + Intergenic
1035179288 7:157077711-157077733 CGGGAGGCTGAGGCTGAGGCAGG - Intergenic
1035181219 7:157090791-157090813 CAGGGGACGCAGGCTGAGACAGG + Intergenic
1035261126 7:157662368-157662390 CAGGAACACCAGGCTGAGCCAGG + Intronic
1035300392 7:157893590-157893612 CGGGAGAAACAGGCTGCGGCAGG + Intronic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036548204 8:9792430-9792452 CAGCTGAAGGAGGCTGAGGCAGG + Intergenic
1036619653 8:10416077-10416099 CTGGGGAAGCAGGCTCAGGCAGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037879620 8:22566346-22566368 CTGGAGCTCCAGGCTGAGGCCGG - Exonic
1037975269 8:23205820-23205842 CGGGAGGCTGAGGCTGAGGCAGG - Intronic
1038056638 8:23864733-23864755 GATGAGAATCAGACTGAGCCTGG + Intergenic
1038136063 8:24787029-24787051 TGGGAGGATGAGGCTGAGGCAGG - Intergenic
1038244770 8:25845337-25845359 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1038320244 8:26519126-26519148 CATGGAAATCAGGGTGAGGCTGG + Intronic
1038772659 8:30497726-30497748 CGGGAGGCTGAGGCTGAGGCAGG - Intronic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1039007850 8:33060510-33060532 CTGTGGGATCAGGCTGAGGCTGG + Intergenic
1039318845 8:36405578-36405600 CTGGGGAATCAGGCTGAGAGAGG + Intergenic
1039734823 8:40320543-40320565 CCTGAGAAGCAAGCTGAGGCTGG + Intergenic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1040394299 8:46980972-46980994 CAGGAGGCTGAGGCTGAGGGAGG + Intergenic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1041308691 8:56491418-56491440 CAGGAGACTCAGGCTGGGTGCGG + Intergenic
1042415324 8:68511461-68511483 CAGGTGACTCAGGATGAGTCAGG + Intronic
1042539692 8:69895716-69895738 CAGGAGGCTAAGGCTGAGGGAGG - Intergenic
1042820050 8:72920529-72920551 CAGGATACTGAGGCTGAGGTGGG + Intronic
1043485808 8:80698309-80698331 CAGGAGAACAGGGCTGAGACTGG + Intronic
1043772870 8:84226516-84226538 CAGGAGAATCACTCAGAGGCAGG - Intronic
1044260778 8:90117703-90117725 CGGGAGGCTGAGGCTGAGGCAGG + Intergenic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1044992271 8:97806708-97806730 CATGAGATTGAGGCCGAGGCTGG + Intronic
1045657885 8:104405871-104405893 CCGGAGCATCTGGCTGTGGCGGG - Intronic
1046819023 8:118616471-118616493 CAAGAGAATCACACAGAGGCAGG + Intronic
1047051822 8:121121296-121121318 TAGGAGAATAAAGCTGAGGTGGG + Intergenic
1047090148 8:121565494-121565516 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1047731605 8:127733478-127733500 CTGGGGTATCAGGCTGAGGTAGG + Intergenic
1048201443 8:132377502-132377524 CAGGAGGATGAGGCTGGGTCAGG + Intronic
1048423317 8:134298459-134298481 CAACACAGTCAGGCTGAGGCTGG + Intergenic
1049170761 8:141159263-141159285 CAGGAGGGTCAGGCAGCGGCAGG + Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049414252 8:142488137-142488159 AAGGAGCACCAGGCAGAGGCTGG - Intronic
1049415226 8:142491970-142491992 CAGGAGGAGCAGGCAGAGGCAGG + Intronic
1049658308 8:143808568-143808590 CAGGGGAATCTGGGTCAGGCAGG + Intronic
1049660609 8:143818183-143818205 CAGGAACATCAAGGTGAGGCAGG - Exonic
1049809032 8:144555037-144555059 CAGGATATCCAGGCAGAGGCAGG - Intronic
1049989479 9:977612-977634 CGGGAGAAGCCGGCTGAGTCTGG + Intronic
1050039195 9:1471001-1471023 CAGGACAAGCAGGTTAAGGCAGG + Intergenic
1050746536 9:8882790-8882812 CAGGAGAATCAGGTGAAGCCAGG + Intronic
1052040932 9:23738309-23738331 GAGGAGACTCAGGCTAAGTCAGG - Intronic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1052864230 9:33455268-33455290 CAGGAGGCTGAGGCTGAGGCAGG + Intergenic
1053404172 9:37856703-37856725 CAGGAGGCTGAGGCTGAGGCAGG + Intronic
1053887275 9:42653506-42653528 CAGCAGAATCAGGCAGAGCCTGG + Intergenic
1054226296 9:62460957-62460979 CAGCAGAATCAGGCAGAGCCTGG + Intergenic
1054800490 9:69343550-69343572 CAGGAGGCTGAGGCTGAGGTGGG - Intronic
1055216313 9:73867203-73867225 CAGGAGAATCAAGCTTAAGTTGG + Intergenic
1055311222 9:74983133-74983155 CAGGAGGCTAAGGCTAAGGCAGG + Exonic
1056203141 9:84295745-84295767 CAGTAGGATGAGGCTGAGGAGGG - Intronic
1056894031 9:90524079-90524101 CAGGAGAGGCACGCTGGGGCTGG + Intergenic
1057165504 9:92922015-92922037 CAGGAGGTTGAGGCTGAGGTGGG - Intergenic
1057192336 9:93095086-93095108 CAGGAAACTGAGGCTCAGGCAGG + Intergenic
1057216762 9:93232878-93232900 CTAGAGAATGAGGCTGAAGCAGG + Intronic
1057336943 9:94163140-94163162 CAGACAAATAAGGCTGAGGCAGG - Intergenic
1059069393 9:111119829-111119851 CATGAGATTCAGGAGGAGGCAGG - Intergenic
1059678693 9:116565578-116565600 CAGGAGACTGAGGCTGAGGTGGG - Intronic
1059697558 9:116743443-116743465 CAGGAGGCTGAGGCTGAGGCAGG + Intronic
1059914406 9:119083198-119083220 GAGGAGATTGAGGCTGAGGGAGG - Intergenic
1060395100 9:123310757-123310779 CAGGGGACTGAGGCTGAGGCAGG - Intergenic
1060576767 9:124703008-124703030 CAGGAGGCTGAGGCTGAGGCAGG - Intronic
1060797389 9:126522054-126522076 CAGGAGTCTGAGGCTGGGGCTGG - Intergenic
1060878235 9:127098875-127098897 CGGGTAAATCAGGCTGATGCTGG - Intronic
1061357327 9:130116266-130116288 CAGAAGAACCAGGCCCAGGCAGG - Intronic
1062145763 9:134988844-134988866 CAGGAGCAAGAGGCAGAGGCAGG + Intergenic
1062215061 9:135384612-135384634 CAGCAGAGTCAGGGAGAGGCAGG - Intergenic
1062424611 9:136500335-136500357 CAGGGAAGTCAGGCAGAGGCGGG - Intronic
1062547137 9:137068971-137068993 CTGGAGAATATGGCTGAGGTGGG + Intronic
1202787992 9_KI270719v1_random:50570-50592 TAGGTGAACCAGGCTCAGGCAGG + Intergenic
1186231882 X:7464011-7464033 CAGGAGGCTGAGGCTGAGGCAGG + Intergenic
1186342878 X:8662109-8662131 CAGGGGCATCAGCCTGATGCAGG - Intronic
1186901785 X:14065398-14065420 CCCAAGGATCAGGCTGAGGCAGG - Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187808591 X:23149930-23149952 AATGAGAGTCAGGCTGAGGCGGG + Intergenic
1188547777 X:31328654-31328676 AAGGAAAATAAGGCTTAGGCAGG - Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189099845 X:38177428-38177450 CAGGAGAATCAGGGTAGGACTGG - Intronic
1189208573 X:39263417-39263439 CTGTGGGATCAGGCTGAGGCTGG - Intergenic
1189357111 X:40318394-40318416 CTGCAAGATCAGGCTGAGGCTGG + Intergenic
1189592866 X:42534140-42534162 CAGTAGGATCAGGGTGAGGCAGG + Intergenic
1189627692 X:42916899-42916921 CAGCAGAATCAGGCTGGAGGAGG + Intergenic
1190136554 X:47804360-47804382 CAGCAAAATCAGGGTGAGGTGGG - Intergenic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1191804556 X:65120642-65120664 CAGGACAATCAGGCAGGGGAAGG - Intergenic
1192422935 X:71050112-71050134 CCGGCTACTCAGGCTGAGGCAGG - Intergenic
1193669267 X:84364593-84364615 CAGGAGAATCAGCTTGAATCCGG - Intronic
1194744099 X:97609583-97609605 TAGGAGAAAAAGGGTGAGGCTGG - Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195392428 X:104376597-104376619 CAGGAGGCTGAGGCTGAGGCAGG - Intergenic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1197774867 X:130112036-130112058 CAGGAGAAGCAGGCCGATGCTGG - Intergenic
1198083927 X:133265483-133265505 CAGTGGAATCCCGCTGAGGCTGG - Intergenic
1198428591 X:136543650-136543672 CAGGAGGCTGAGGCTGAGGCGGG + Intronic
1198506914 X:137310078-137310100 CAGGTGAAACAGGCTCAGGGAGG - Intergenic
1199565363 X:149210074-149210096 AAGGAAACTAAGGCTGAGGCAGG + Intergenic
1199713318 X:150487744-150487766 CAGGAGAACCTGACTTAGGCTGG - Intronic
1201296673 Y:12469330-12469352 CAGGTGACTCAGGATGAGTCAGG + Intergenic
1201325765 Y:12756075-12756097 CAGCAGAATCAGGCAGGTGCTGG + Intronic
1201668400 Y:16487033-16487055 CAGGAGACTCAGTTTGAGCCAGG - Intergenic