ID: 1110094696

View in Genome Browser
Species Human (GRCh38)
Location 13:71502480-71502502
Sequence ATGGTTAAACAGCTCCGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110094696_1110094700 17 Left 1110094696 13:71502480-71502502 CCTTGTCGGAGCTGTTTAACCAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1110094700 13:71502520-71502542 ATTGATGCATGCATTCTATGGGG 0: 1
1: 0
2: 0
3: 17
4: 174
1110094696_1110094699 16 Left 1110094696 13:71502480-71502502 CCTTGTCGGAGCTGTTTAACCAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1110094699 13:71502519-71502541 AATTGATGCATGCATTCTATGGG 0: 1
1: 0
2: 0
3: 11
4: 177
1110094696_1110094698 15 Left 1110094696 13:71502480-71502502 CCTTGTCGGAGCTGTTTAACCAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1110094698 13:71502518-71502540 AAATTGATGCATGCATTCTATGG 0: 1
1: 0
2: 0
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110094696 Original CRISPR ATGGTTAAACAGCTCCGACA AGG (reversed) Intronic
916810968 1:168305258-168305280 ATGGATAAACAGCTAGGAAAAGG + Intronic
921971948 1:221159551-221159573 TGGGTTAAACAGATCAGACATGG + Intergenic
1066196860 10:33108713-33108735 AAAGTTACACAGCTCAGACATGG + Intergenic
1066202237 10:33152831-33152853 TTTGTTAACCAGCTACGACAAGG - Intergenic
1072954527 10:99877031-99877053 ATGGTTAAGCAACGCAGACAGGG + Exonic
1088751561 11:112846476-112846498 ATGGTTAGACAGCTTCCAGAAGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1101827163 12:108229398-108229420 AAAGTCAAACAGCTCTGACATGG + Intronic
1107288271 13:38821820-38821842 ATAGACAAACAGCTCCAACAAGG + Intronic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1115554471 14:34533496-34533518 AAGTTGCAACAGCTCCGACAAGG - Exonic
1119327305 14:73768286-73768308 AAGGTTAAACAGCTCTGCCAAGG + Intronic
1124873880 15:33572532-33572554 ATGGCAAAACAGCTCCAACAGGG - Intronic
1124991152 15:34674988-34675010 ATGGTAGACCAGCTCTGACAAGG + Intergenic
1144410989 17:15001628-15001650 ATGGCTCAACACCTCCCACAAGG - Intergenic
1146917247 17:36686142-36686164 ATGGTCACACAGCTGCGAAAGGG - Intergenic
1159196434 18:65122344-65122366 ATGGTTAAACAGCCAAGGCATGG + Intergenic
1159592731 18:70352621-70352643 ATGGTTAATCAGCTACAAGATGG - Intergenic
1162616531 19:11805505-11805527 ATGTTTAAACAATTCAGACAGGG + Intronic
931880433 2:66564153-66564175 GTGGTCAAACAGCTCAGAAAAGG + Intronic
937255410 2:120552051-120552073 ATGGTTAAGTAGCTCCTCCAAGG + Intergenic
939166461 2:138646187-138646209 ATGGTTAAACTGCTCATACAAGG + Intergenic
945867429 2:215191807-215191829 ATAGTTAAGCAGCTCCAAAATGG + Intergenic
949075358 2:242054329-242054351 ATGTTTAAACACCTCAGGCAGGG + Intergenic
1168894948 20:1317971-1317993 ATGGATAAACAGAGCCGAGAGGG - Intronic
1170121829 20:12920650-12920672 ATGGTAAAACATATCCCACAGGG - Intergenic
1172747622 20:37225029-37225051 ATGGTTACAGAGCTCAGACCTGG - Intronic
1176274590 20:64256553-64256575 ATGGCTAAACAGCTCCTATCTGG + Intronic
1179051466 21:37892102-37892124 ATGTTTCAAAAGCTCCCACATGG - Intronic
1180643088 22:17315199-17315221 ATCCTTAAACAGCTCCTAGAGGG - Intergenic
966623870 3:181995593-181995615 ATGGTTAAAGAGTTGTGACATGG - Intergenic
970898438 4:21130598-21130620 ATTTTTAAATAGCTCCTACATGG - Intronic
972416183 4:38842686-38842708 ATGGCCACCCAGCTCCGACAGGG + Intronic
974951723 4:68591130-68591152 ATGGGTGAACAGCTCCCAGAAGG + Intronic
975949006 4:79745293-79745315 ATGCTTAAACAGCTCTCGCAAGG + Intergenic
981725514 4:147843204-147843226 ATGGTTCAAAATCTCTGACACGG - Intronic
992445296 5:76827895-76827917 ATGGTTAAAGAGTTCCTATATGG - Intronic
1001614172 5:173029095-173029117 ATAGAAAAACAGCTCCCACAGGG - Intronic
1005868560 6:29956612-29956634 ATGGGTACACAGCTGCGACGTGG + Intergenic
1018491779 6:164301422-164301444 ATGTTTAAAGAGGTCAGACATGG - Intergenic
1022145656 7:27537312-27537334 ATAGTTAAACATCTGAGACAAGG + Intronic
1030077881 7:105752063-105752085 CTGGTTAAGCAGCTTCTACAAGG + Intronic
1037985975 8:23290657-23290679 AGGGTCAAGCAGCTCCTACATGG - Intronic
1038703994 8:29877065-29877087 ATGGGTAGACAGCCCTGACAGGG + Intergenic
1049474406 8:142790119-142790141 CTGCTTAGACAGCTCCAACAAGG - Intergenic
1056070531 9:82982186-82982208 ATGAAGAAACAGATCCGACATGG + Exonic
1203779047 EBV:90652-90674 ATGTTTCAACCGCTCCGACTGGG - Intergenic
1186168766 X:6855487-6855509 ATGGATAAACATCTAAGACAGGG - Intergenic
1188260512 X:28017320-28017342 ATGGTTCAACTGGTCCTACAGGG - Intergenic
1189446837 X:41087337-41087359 AAGGGTAATCAGCTCCGAGAGGG - Intronic
1199968399 X:152840134-152840156 ATGGTTTTTCAGCTCCGTCAGGG + Intronic