ID: 1110094698

View in Genome Browser
Species Human (GRCh38)
Location 13:71502518-71502540
Sequence AAATTGATGCATGCATTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110094696_1110094698 15 Left 1110094696 13:71502480-71502502 CCTTGTCGGAGCTGTTTAACCAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1110094698 13:71502518-71502540 AAATTGATGCATGCATTCTATGG 0: 1
1: 0
2: 0
3: 17
4: 230
1110094697_1110094698 -4 Left 1110094697 13:71502499-71502521 CCATGAAAGTACTACTTTTAAAT 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1110094698 13:71502518-71502540 AAATTGATGCATGCATTCTATGG 0: 1
1: 0
2: 0
3: 17
4: 230
1110094695_1110094698 16 Left 1110094695 13:71502479-71502501 CCCTTGTCGGAGCTGTTTAACCA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1110094698 13:71502518-71502540 AAATTGATGCATGCATTCTATGG 0: 1
1: 0
2: 0
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110094698 Original CRISPR AAATTGATGCATGCATTCTA TGG Intronic
906237247 1:44219412-44219434 AACTTGATGCCTGCAGTCTCAGG - Exonic
911926991 1:103845387-103845409 AAATTGATTCATGCTATATAAGG - Intergenic
912042124 1:105404323-105404345 AGCTGGATGCATGCATTGTATGG - Intergenic
912911710 1:113767309-113767331 AAATAGATGCATAGTTTCTAAGG + Intronic
915256568 1:154635632-154635654 AATTTTATATATGCATTCTAGGG + Intergenic
917989022 1:180353207-180353229 AAATTTATCCATTCATTCTGTGG - Intronic
919709606 1:200712624-200712646 AAATTGGAGCATGCCTTATATGG + Intergenic
920877981 1:209855086-209855108 AAATTGATGTAAGCATTGGAAGG + Exonic
921413625 1:214865194-214865216 AAATTGATTTATCCATTCTCCGG - Intergenic
922360883 1:224820190-224820212 CATTTGTTGCATGCTTTCTAAGG - Intergenic
1064294987 10:14070939-14070961 CAATTGATGCATCCAATCAAAGG + Intronic
1064910136 10:20392223-20392245 AAGTTGGTGGATGCAGTCTAGGG + Intergenic
1065492038 10:26291945-26291967 AAATGGATGCAGGAATTTTAGGG - Intronic
1066484752 10:35832565-35832587 GAGTTTATGCCTGCATTCTAGGG - Intergenic
1066597762 10:37070709-37070731 AAATGGATGCATGTAGACTAAGG - Intergenic
1067305352 10:45059118-45059140 GAGTTTATGCTTGCATTCTAGGG - Intergenic
1067708346 10:48627743-48627765 AATGTGAGGCATGCATTCTCAGG + Intronic
1069060612 10:63890771-63890793 AAATGGAATCATGCAATCTATGG + Intergenic
1069182776 10:65383901-65383923 AAATAGATGAATTCATTATAAGG + Intergenic
1071411216 10:85398678-85398700 AAATTGATTCAATCTTTCTAAGG + Intergenic
1073940497 10:108692578-108692600 AAAGTGTTGCATGCTCTCTAAGG - Intergenic
1074945192 10:118274719-118274741 AAGTTGATCCATGCATTCCTGGG - Intergenic
1074971538 10:118543428-118543450 TAATTTATTCATGTATTCTACGG + Intergenic
1075487380 10:122835979-122836001 AAATTGCTGCATTCATTTTCAGG - Intronic
1079065552 11:17288137-17288159 AAATTGATAAAGGTATTCTAAGG - Intronic
1079716874 11:23758035-23758057 AAAATGATTCTTTCATTCTATGG - Intergenic
1079912066 11:26323073-26323095 AAATTGATGAAAGCAGTCAAAGG - Intronic
1080039917 11:27748754-27748776 ATAAAGATGCATGCATTCTGTGG - Intergenic
1081222371 11:40477448-40477470 ATATTGATGCATCCCTTTTAAGG - Intronic
1081419478 11:42856582-42856604 AAAATGATGCATATATACTAAGG + Intergenic
1086426201 11:86685035-86685057 AAATTGATCCATGCCTGCTGGGG - Intergenic
1087361940 11:97171549-97171571 AAATTGAGGCTTAGATTCTATGG - Intergenic
1088090321 11:106031089-106031111 AAATTGAAGCATGGAGTTTAAGG + Intergenic
1088250487 11:107857557-107857579 AAATTGATGCATGTGTTTAAAGG - Intronic
1090053162 11:123398510-123398532 AAATTGATACAAGTATGCTATGG - Intergenic
1092663617 12:10768153-10768175 GAAGAAATGCATGCATTCTAAGG + Intergenic
1093271019 12:17061893-17061915 GAATAAATGCATGCATTCCAAGG - Intergenic
1093487704 12:19669762-19669784 AATTTGATACATGCATACAATGG + Intronic
1094091780 12:26657982-26658004 AAAATGATGCATCCATTATCTGG + Intronic
1096589724 12:52649568-52649590 AACTTTAAGCAGGCATTCTAAGG + Intronic
1098117877 12:67199741-67199763 AAATTGATTTATACATTCTCAGG - Intergenic
1099270615 12:80504924-80504946 AATGTGATGCATTCATTCTCAGG - Intronic
1099351758 12:81579598-81579620 CAATTGATGTATGCATTGTGAGG - Intronic
1099481385 12:83170610-83170632 AAAATTACTCATGCATTCTAAGG - Intergenic
1099860679 12:88222189-88222211 AAATGGATTCAAGCATTCTGTGG + Intergenic
1099934612 12:89110447-89110469 GAATTGATGCCTTCATTCTCTGG + Intergenic
1100212051 12:92407770-92407792 AAATTAATGCATGTATTGCATGG - Intergenic
1100904268 12:99279546-99279568 AAATGGAAGCATGCAATCTGTGG + Intronic
1101300672 12:103476934-103476956 AAATTGAAGTATGAAATCTATGG - Intronic
1103498562 12:121382247-121382269 AAATTGATACACCCATTCTCTGG + Intronic
1106013288 13:25844962-25844984 AAATTCTTGGAAGCATTCTAGGG - Intronic
1106154158 13:27136717-27136739 AACTTGATATATGCATTATATGG + Intronic
1107144783 13:37049139-37049161 ATAATGATGCATGCTTTCAATGG - Intronic
1107216492 13:37926327-37926349 AAATTAATGCGTGCAATGTAGGG + Intergenic
1107613400 13:42139668-42139690 AAATGAATGAATGAATTCTAAGG - Intronic
1108119401 13:47167014-47167036 AAATTGACCCATTCATTATAAGG + Intergenic
1108716402 13:53082587-53082609 AAACTGTTTCATCCATTCTATGG - Intergenic
1109733344 13:66447237-66447259 CAATTGAAGCATCCATTTTATGG + Intronic
1110094698 13:71502518-71502540 AAATTGATGCATGCATTCTATGG + Intronic
1110716814 13:78715194-78715216 ATATTGATGCATGCTTTATTGGG + Intergenic
1111593176 13:90376117-90376139 AAATAGAAGCATGAATTCTATGG + Intergenic
1112910406 13:104475956-104475978 ATATTGATGAAAGCATGCTAGGG + Intergenic
1113235786 13:108271352-108271374 AAATTATTGCATGTATTCTGTGG - Intronic
1114738848 14:25072371-25072393 AATTTTGTGCATGCATTCAAAGG - Intergenic
1115081938 14:29464231-29464253 AAATTGATTCATGAATTCTCAGG + Intergenic
1117865075 14:60138887-60138909 AATTTGGTGCAGGAATTCTAAGG + Exonic
1118048418 14:61998556-61998578 AAACTGGTGCATTCATTCAATGG - Intronic
1118515387 14:66522430-66522452 AAATGGAGGGATGCATTATATGG - Intronic
1119506512 14:75177538-75177560 TAATTCATGCATTCATTCAATGG + Intergenic
1120019631 14:79513936-79513958 AAATTAATACTTACATTCTAAGG + Intronic
1120832980 14:89014460-89014482 AATTTGATACGTGCATTCAAAGG - Intergenic
1121807191 14:96838886-96838908 AAATTGAGGCATGATTTTTACGG + Intronic
1122261350 14:100524881-100524903 AATTTGATGTATACATTTTAAGG + Intronic
1124195694 15:27625439-27625461 AAATTGCTACATGTTTTCTAAGG + Intergenic
1126802633 15:52313533-52313555 AAAGTGATGAAAGTATTCTAGGG + Exonic
1129039283 15:72671540-72671562 AACTTGAAGCATGCAGCCTATGG - Intergenic
1132039041 15:98509457-98509479 AAATGAATGCATGCCTTCAAAGG + Intronic
1133069700 16:3237102-3237124 AAATTGGTGCATTCATACTCTGG + Intergenic
1135386480 16:22045669-22045691 TAATTAATGCATATATTCTATGG + Intronic
1135791624 16:25401835-25401857 AGATTACTGCCTGCATTCTATGG + Intergenic
1135858817 16:26036551-26036573 AAATGGAGGCATCCATTATAAGG - Intronic
1136033257 16:27518891-27518913 AAATTAATGAATGCATTCAAGGG + Intronic
1139042805 16:63018283-63018305 AAATGGCTGCATCCATGCTATGG - Intergenic
1139262367 16:65606963-65606985 ACACACATGCATGCATTCTAAGG + Intergenic
1140665886 16:77227116-77227138 ACATTGATGCATGCCTTCATTGG - Intergenic
1140950700 16:79814585-79814607 AAATTAATTGATGCATTCTCTGG + Intergenic
1142680272 17:1543516-1543538 TAATTGAACCATGCTTTCTAAGG - Intronic
1142725045 17:1807273-1807295 AAATTGATACATCCATTTAATGG + Intronic
1145530065 17:24397366-24397388 AAATTGACAGATGCATTCTCAGG + Intergenic
1145538942 17:24526267-24526289 AAATTGACAGATGCATTCTCAGG + Intergenic
1145613991 17:25618444-25618466 AAATTGACAGATGCATTCTCAGG + Intergenic
1145624091 17:25765737-25765759 AAATTGACAGATGCATTCTCAGG + Intergenic
1145631671 17:25875872-25875894 AAATTGACAGATGCATTCTCAGG + Intergenic
1150543922 17:66133280-66133302 AAAATGAAGCATATATTCTACGG + Intronic
1150972817 17:70048964-70048986 AAAATGCTGCATGAATTTTACGG + Intergenic
1156724459 18:40111382-40111404 AAAATAATGCCTTCATTCTAGGG + Intergenic
1156880101 18:42067299-42067321 AAACTGATGCAGACATTATAAGG - Intronic
1157037524 18:43993296-43993318 AAATTGAATCATGCATTATATGG - Intergenic
1157052674 18:44185779-44185801 AAATCGATGCATGTATTAAAAGG + Intergenic
1159513029 18:69421051-69421073 AAAGTGATGCATGCATCTTAGGG - Intronic
1160471556 18:79139592-79139614 ATTTTGATGCAGGCATTCAATGG + Intronic
925789600 2:7470562-7470584 AAATTGATGAATGCCTTATGAGG + Intergenic
926582896 2:14650559-14650581 AAATTGAGGCATGCTTTGAAAGG - Intronic
930891060 2:56388566-56388588 AATTTGACGCATGCATTGTATGG + Intergenic
931239801 2:60442025-60442047 AAATGCAAGCATGCATTCCAAGG - Intergenic
931913387 2:66926504-66926526 AAATGGCTGCCTGCATTCAAAGG - Intergenic
933370257 2:81406273-81406295 AATTTGATCCATGAATTCCAAGG + Intergenic
935725099 2:106017049-106017071 GATTTAAGGCATGCATTCTAGGG + Intergenic
938256748 2:129865258-129865280 AAATTGAAGAATGAATTCGAGGG - Intergenic
939439238 2:142222137-142222159 AAATAGATCCATAAATTCTATGG + Intergenic
939764951 2:146236284-146236306 AAATTGATACAGCCTTTCTAGGG + Intergenic
939998667 2:148945299-148945321 AAATTTTTGCATGTACTCTAAGG + Intronic
943846728 2:192659037-192659059 AAAATCATGAATGCTTTCTAGGG + Intergenic
946486664 2:220107081-220107103 AAATTTATAAATGCATTCTATGG + Intergenic
948358714 2:237402457-237402479 AAATTGATGGCTACATTTTAGGG - Intronic
948616366 2:239201931-239201953 AAGTAGATGCATGCATAATAAGG + Intronic
1171138473 20:22719739-22719761 AAGTTGATGCATGCATTTGCAGG - Intergenic
1180289365 22:10783222-10783244 AAATTGATGCAGCCTTTTTAGGG + Intergenic
1182032343 22:27169068-27169090 AAATGGATGTATGGATTTTATGG + Intergenic
1184774044 22:46614629-46614651 AAATTCATGAAAGCATTCTGTGG + Intronic
949089818 3:13505-13527 GAATTGAAGCAAGCCTTCTAAGG + Intergenic
949357483 3:3197397-3197419 AAATTTATAAATACATTCTAAGG - Intergenic
949696894 3:6708030-6708052 AAATTCATGGATGAATTGTACGG + Intergenic
949696901 3:6708089-6708111 AAATTCATGGATGAATTGTATGG + Intergenic
949885361 3:8688850-8688872 AAATTGTTCCCTCCATTCTAAGG + Intronic
950564794 3:13762189-13762211 AAACTGAGGCATGGATACTATGG - Intergenic
953273113 3:41465810-41465832 AAATTGATCCATGGATTCAAGGG + Intronic
955262513 3:57407529-57407551 AAATGGATGGAAGGATTCTAGGG + Intronic
955791000 3:62588531-62588553 CAATTGGTGCATGCACTTTAGGG + Intronic
956561748 3:70585706-70585728 AAATTGTTACAAGCATTTTAAGG + Intergenic
956596727 3:70975436-70975458 AAGTTGATGAATTAATTCTATGG + Intronic
956614917 3:71161136-71161158 AAATTGAGGCTTGCTTTCCAAGG + Intronic
957029494 3:75223240-75223262 GAATTGAAGCAAGCCTTCTAAGG + Intergenic
961151056 3:124638192-124638214 AAAATGATGGATGCTCTCTATGG + Intronic
961902792 3:130230009-130230031 AAATTGATGCATTCCTTTTTTGG + Intergenic
962021205 3:131503446-131503468 GAAATGATGTATGCCTTCTAGGG + Intergenic
962945264 3:140163378-140163400 GAATTGATTCATGCATTTTGTGG - Intronic
963790336 3:149576870-149576892 AAATTGATGCATGAATACACAGG + Intronic
963921772 3:150912462-150912484 AAATTGATGGAGGCATCCAATGG - Intronic
964919234 3:161875664-161875686 TAATTGTTCCATGCTTTCTACGG - Intergenic
966654355 3:182338454-182338476 AAATTGATACATTCATTTTTGGG + Intergenic
967020706 3:185519926-185519948 ATTTTGATGCAGGCAATCTATGG - Intronic
969992396 4:11277990-11278012 ACCTGGATGCAGGCATTCTATGG - Intergenic
969992403 4:11278040-11278062 AATTGGATGCAGGCATTCAATGG - Intergenic
969992409 4:11278090-11278112 AATTGGATGCAGGCATTCAATGG - Intergenic
969992415 4:11278140-11278162 AATTGGATGCAGGCATTCAATGG - Intergenic
969992445 4:11278339-11278361 ACCTGGATGCAGGCATTCTATGG - Intergenic
969992453 4:11278389-11278411 ACCTGGATGCAAGCATTCTATGG - Intergenic
969992464 4:11278464-11278486 ACCTGGATGCAGGCATTCTATGG - Intergenic
969992471 4:11278514-11278536 AATTGGATGCAGGCATTCAATGG - Intergenic
969992477 4:11278564-11278586 AATTGGATGCAGGCATTCAATGG - Intergenic
969992483 4:11278614-11278636 AATTGGATGCAGGCATTCAATGG - Intergenic
969992539 4:11278964-11278986 ACCTGGATGCAGGCATTCTATGG - Intergenic
973566016 4:52188386-52188408 AAATTCCTGAATCCATTCTATGG - Intergenic
973945185 4:55948467-55948489 ATTTTGATGGATGAATTCTATGG + Intergenic
974268019 4:59611091-59611113 AAATTGAGACAGGCATACTAAGG + Intergenic
974781432 4:66559138-66559160 AAAAAGATACATGCATTCTTTGG + Intergenic
980314018 4:131173025-131173047 AATTAGATGCATACATTTTAAGG + Intergenic
980909903 4:138984530-138984552 AAGTTGATACATTCATACTATGG - Intergenic
981327899 4:143472803-143472825 AGAAAGATACATGCATTCTATGG + Exonic
982496452 4:156099683-156099705 AACCTGATGCATGCCTTCTTGGG + Intergenic
983848910 4:172555153-172555175 AAATTGATGAATTCCTGCTATGG - Intronic
984401409 4:179270034-179270056 AAATAAATGCAGGCATTTTATGG + Intergenic
984407008 4:179345735-179345757 ATATTAATGAATGCCTTCTAAGG + Intergenic
984485049 4:180357703-180357725 AATTTCATGAATGCATTGTAGGG - Intergenic
984661967 4:182383893-182383915 AATTTGATGTATCCATTCTTAGG - Intronic
984810395 4:183791138-183791160 AAATTGGTGCATGCATTTCTTGG + Intergenic
986420391 5:7574796-7574818 AAATTTTTGCATGCATTCATTGG - Intronic
987429888 5:17819961-17819983 AAACTGATGTATGCATACCACGG - Intergenic
990004223 5:50926260-50926282 ATATTGATTCATCCAATCTATGG - Intergenic
990210037 5:53472644-53472666 AAAATGTTGCATTCATTTTAAGG - Intergenic
990948565 5:61274738-61274760 AAAATGATACATACATTCCAAGG + Intergenic
990997480 5:61746878-61746900 AAACTGATGCAGGGATTCTACGG - Intronic
993543536 5:89182534-89182556 AATATGCTGAATGCATTCTAGGG - Intergenic
994301375 5:98152277-98152299 AAATTGAGCCATAGATTCTAGGG - Intergenic
995198488 5:109399934-109399956 GAAATGAAGAATGCATTCTATGG + Intronic
995726261 5:115183850-115183872 CACTTGCTGCATGCATTCAATGG - Intergenic
999420576 5:151438840-151438862 TAATAGATGCATGCACTCTGAGG - Intronic
1000188351 5:158883046-158883068 AAATGGCTGCAGGCATTTTATGG - Intronic
1002365692 5:178708684-178708706 AACTTGATGCATGCCTGCAAGGG + Intergenic
1004994121 6:21171599-21171621 AAAGTGATGTATCCATTCAATGG - Intronic
1008098257 6:47362264-47362286 AAATTGATGAATACATTCAGTGG - Intergenic
1010424424 6:75711545-75711567 AACTTGAGGCATGCTATCTAGGG + Intronic
1013166285 6:107595433-107595455 AAATAGATCCATTCACTCTAAGG - Intronic
1014772384 6:125471668-125471690 GAAGTGATGCATGCAAGCTATGG + Intergenic
1014973753 6:127851928-127851950 AATTTGATGTATGCTTTCTATGG + Intronic
1015431906 6:133141767-133141789 AGATTGCTGCATGCATTATATGG + Intergenic
1016366431 6:143323572-143323594 AAATTGATGCATTAATTTTTTGG + Intronic
1018413183 6:163576735-163576757 ATATTGATACATGCATTTTCTGG - Exonic
1021121930 7:16805620-16805642 AAGTTGCTGCATACATTCAATGG - Intronic
1021384104 7:20007135-20007157 TAATTAATGTATCCATTCTAAGG - Intergenic
1021996236 7:26180415-26180437 TAATTAATGGATGCATTGTATGG + Intronic
1027858249 7:83540493-83540515 GAATAGGTACATGCATTCTAGGG - Intronic
1028177604 7:87675538-87675560 AAATTAATGTATGCATATTATGG + Intronic
1028256412 7:88603685-88603707 ATATTTATGCATGGATTCTGTGG - Intergenic
1028268939 7:88762652-88762674 AAATAGATGAATGTATTTTATGG - Intronic
1028278069 7:88883265-88883287 AATGTGATGCATGCAGTCTCTGG - Intronic
1030427564 7:109398399-109398421 AAAATGATGCATGCATATAATGG - Intergenic
1030879547 7:114860696-114860718 AAATTGATGTATAAAATCTAAGG - Intergenic
1031943335 7:127812952-127812974 AATTTGATTCATTCATGCTATGG + Intronic
1034002281 7:147428511-147428533 AAATTGAATCCTCCATTCTAGGG - Intronic
1034615833 7:152416046-152416068 AAATTGATGCAACCTTTTTAGGG + Intronic
1039271724 8:35888880-35888902 AAATTGATGCCTGTGTTCTAGGG - Intergenic
1039304543 8:36247297-36247319 AAAATGATGGATGCTTGCTAAGG + Intergenic
1040804936 8:51384218-51384240 AAATTGATGCAGTCATCCTGAGG - Intronic
1042078025 8:65017239-65017261 AGAATAATGCATGCATCCTAGGG - Intergenic
1043175163 8:77016032-77016054 AAAATGTTGCATGCATTATGAGG - Intergenic
1043710424 8:83410199-83410221 AAATTGATAGATGCTTTCTGGGG - Intergenic
1044164519 8:88965692-88965714 AAATTGGTGCATACTGTCTATGG - Intergenic
1044465911 8:92505207-92505229 AAATTGCTGCATGCAGTCGTAGG - Intergenic
1044503239 8:92987341-92987363 AAACTGATGAATACATTCTTTGG - Intronic
1044762240 8:95533149-95533171 ATATAGATGCAAACATTCTACGG + Intergenic
1045758963 8:105581302-105581324 ACATTGATTCATTCATTCTTTGG - Intronic
1046005177 8:108471865-108471887 AAATTGATGTTACCATTCTAGGG - Intronic
1046206296 8:111002041-111002063 AAATATATGCATACATTTTATGG - Intergenic
1046468646 8:114638706-114638728 AAATTGATGAATGGTATCTAAGG - Intergenic
1047163641 8:122411062-122411084 AAAGTGATGCCTGCATTCTTTGG + Intergenic
1048066607 8:130975943-130975965 AAATTATAGCATGCATTTTAAGG - Intronic
1048250649 8:132864161-132864183 AGCTTTATGCATGCATTTTAGGG + Intergenic
1050317874 9:4421864-4421886 AAGCTGATCCATGCATTCTAGGG - Intergenic
1052479567 9:29006405-29006427 AAAGAGATGCATGAATTATATGG - Intergenic
1056829532 9:89903870-89903892 AAATTGAATCAGGGATTCTATGG + Intergenic
1056845991 9:90038825-90038847 CAATTGATGCATTCATTGGATGG + Intergenic
1056916539 9:90751505-90751527 AAATTGTTCCCTCCATTCTAAGG - Intergenic
1057166263 9:92929111-92929133 AAATTGGTGCAAGCATGGTAAGG + Intergenic
1057501422 9:95599704-95599726 AAATTGATGAATACCTTCTAAGG + Intergenic
1057590840 9:96372038-96372060 AATTTCATACATGCATGCTATGG + Intronic
1059671130 9:116493552-116493574 AAATTGATCCATGCTTTGTTGGG - Intronic
1060572454 9:124654937-124654959 AAACTGATGCATCCATTCCAGGG + Intronic
1185879171 X:3725250-3725272 AAACAGAAGCTTGCATTCTAAGG - Intergenic
1186372412 X:8960630-8960652 AAAGTGAGGCATGAATTCAAGGG - Intergenic
1186750380 X:12615601-12615623 GAATGGATCCATTCATTCTATGG + Intronic
1187139393 X:16577996-16578018 TAGTTCAGGCATGCATTCTAAGG + Intergenic
1187808890 X:23153701-23153723 AACGTGATGAATGCATACTATGG + Intergenic
1189419089 X:40840371-40840393 AAATTAATGCATACATAATAGGG - Intergenic
1190125881 X:47705044-47705066 AGATTGCTGCAGGTATTCTAGGG - Intergenic
1190925860 X:54903642-54903664 CAGTTTATGCATGCATTCTACGG - Intergenic
1191794820 X:65010095-65010117 AAGTTGATGCATCCTTTTTATGG - Intronic
1192285338 X:69729018-69729040 AAATTGATGCAGAGATTCTTAGG + Intronic
1192479911 X:71476179-71476201 AAATTGATCTATGAATTCCAAGG + Intronic
1194270379 X:91806928-91806950 TTATAGATGTATGCATTCTAAGG + Intronic
1194937088 X:99963831-99963853 AAATTGAAGTATACATACTAAGG + Intergenic
1195499876 X:105583450-105583472 AAATTGATGCAAGGATACTCAGG + Intronic
1197578254 X:128249806-128249828 TAATTGTTGCATCTATTCTAGGG - Intergenic
1198808745 X:140513661-140513683 AAATTGATGCTTCCATTTGATGG + Intergenic
1199754814 X:150854176-150854198 AAGTTGAAGTATGCATTCTCTGG - Intronic
1200587611 Y:5028360-5028382 TTATAGATGTATGCATTCTAAGG + Intronic
1201505139 Y:14690231-14690253 AAATTTATGTTTACATTCTAGGG - Intronic