ID: 1110094699

View in Genome Browser
Species Human (GRCh38)
Location 13:71502519-71502541
Sequence AATTGATGCATGCATTCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110094695_1110094699 17 Left 1110094695 13:71502479-71502501 CCCTTGTCGGAGCTGTTTAACCA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1110094699 13:71502519-71502541 AATTGATGCATGCATTCTATGGG 0: 1
1: 0
2: 0
3: 11
4: 177
1110094697_1110094699 -3 Left 1110094697 13:71502499-71502521 CCATGAAAGTACTACTTTTAAAT 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1110094699 13:71502519-71502541 AATTGATGCATGCATTCTATGGG 0: 1
1: 0
2: 0
3: 11
4: 177
1110094696_1110094699 16 Left 1110094696 13:71502480-71502502 CCTTGTCGGAGCTGTTTAACCAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1110094699 13:71502519-71502541 AATTGATGCATGCATTCTATGGG 0: 1
1: 0
2: 0
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110094699 Original CRISPR AATTGATGCATGCATTCTAT GGG Intronic
902828604 1:18995210-18995232 AATGAATGCATGCATGCTTTTGG + Intergenic
908053495 1:60258407-60258429 ATTTAATGCATGCCTACTATGGG + Intergenic
910416122 1:87000942-87000964 AATTAATGCCTGCAGTATATTGG + Intronic
911741694 1:101393222-101393244 AATTGCTACATCCACTCTATTGG - Intergenic
912042123 1:105404322-105404344 GCTGGATGCATGCATTGTATGGG - Intergenic
912060724 1:105665115-105665137 CACTGATGCATCCAGTCTATTGG + Intergenic
916610409 1:166386077-166386099 AATAGATGCATATATTCTAATGG - Intergenic
917871597 1:179247226-179247248 AATTAATGCATGCATACCTTCGG - Intergenic
918983246 1:191590774-191590796 AACTAATGCATGCATTCTCAAGG - Intergenic
919312764 1:195932267-195932289 AATTGATTCATGCTTTCCAGTGG - Intergenic
921393683 1:214645033-214645055 AATTGAAGCATGCATAGAATTGG + Exonic
921965822 1:221087794-221087816 AGTAGATGCATACATTCTAATGG - Intergenic
922074815 1:222233170-222233192 TTTTGATGCATGCATTTTTTTGG - Intergenic
923209922 1:231794534-231794556 CATTGATTCATTCATTCTACAGG + Intronic
1064294988 10:14070940-14070962 AATTGATGCATCCAATCAAAGGG + Intronic
1065052321 10:21807741-21807763 AATTTATGCATGTATTGTAGAGG - Intronic
1065552241 10:26879519-26879541 AATTTATCCATGCAGTGTATTGG + Intergenic
1067053655 10:43039190-43039212 GGGTGAAGCATGCATTCTATAGG - Intergenic
1070425895 10:76286741-76286763 AATTGAGTCATCCATTCTTTTGG + Intronic
1074971539 10:118543429-118543451 AATTTATTCATGTATTCTACGGG + Intergenic
1075500847 10:122972540-122972562 AATTGATGCATACATACAACTGG + Intronic
1078771440 11:14356339-14356361 AATTGATGAAAGCATTATGTAGG - Intronic
1078879571 11:15434783-15434805 AATTGATGCATGTTTGCTCTTGG + Intergenic
1079528213 11:21416021-21416043 AATTGAAGTATGCATTGTTTTGG + Intronic
1080039916 11:27748753-27748775 TAAAGATGCATGCATTCTGTGGG - Intergenic
1082046241 11:47730502-47730524 AATTGATGCTTGTACTCTACTGG - Intronic
1084412455 11:69012678-69012700 CATTCAAGCATGCATTCTAGAGG - Intronic
1086236182 11:84633718-84633740 TATTGATGAATGCAGACTATGGG + Intronic
1087361939 11:97171548-97171570 AATTGAGGCTTAGATTCTATGGG - Intergenic
1092675891 12:10918606-10918628 CATTGGTGCATGCATTTTGTAGG - Intronic
1093271018 12:17061892-17061914 AATAAATGCATGCATTCCAAGGG - Intergenic
1093640033 12:21516141-21516163 AAGTGATGCATGAATTCGATTGG + Exonic
1094091781 12:26657983-26658005 AAATGATGCATCCATTATCTGGG + Intronic
1097969181 12:65614160-65614182 AATTGTTGAATGCATGCTTTAGG + Intergenic
1100073024 12:90744530-90744552 AATTAATTCATGAATTCTAGAGG + Intergenic
1100221547 12:92509515-92509537 AATATCTGCATACATTCTATTGG + Intergenic
1100418963 12:94410698-94410720 AATTAATGCATTGATTCTACAGG + Intronic
1100904269 12:99279547-99279569 AATGGAAGCATGCAATCTGTGGG + Intronic
1101788611 12:107908670-107908692 AATTCATTCATTCATTCAATAGG + Intergenic
1103640000 12:122343089-122343111 AATTGAGGCTTTCATTCTACAGG - Intronic
1109031991 13:57202716-57202738 AAATGAAGCATTCATTCTGTAGG - Intergenic
1110005462 13:70260931-70260953 AGTTGATGGATGCATTTTAGTGG + Intergenic
1110094699 13:71502519-71502541 AATTGATGCATGCATTCTATGGG + Intronic
1110282370 13:73709888-73709910 AATTGATGAATGTATTGAATGGG - Intronic
1111812797 13:93112994-93113016 ATAAGATCCATGCATTCTATAGG - Intergenic
1112563012 13:100530231-100530253 AATTGATTCAAGCATTATACAGG + Exonic
1115081939 14:29464232-29464254 AATTGATTCATGAATTCTCAGGG + Intergenic
1116539909 14:46089036-46089058 AATTGTTGCAAGCACCCTATTGG - Intergenic
1120465030 14:84845431-84845453 AATTGATGCATACATAATGTTGG - Intergenic
1122319933 14:100848758-100848780 AATAAATGCGTGCATTCCATAGG + Intergenic
1123005630 14:105321793-105321815 CTTTGATGCAAGCATTCTTTTGG + Intronic
1125344893 15:38709305-38709327 CATCCATGCATGCTTTCTATTGG + Intergenic
1125846525 15:42859932-42859954 AAATGATGAATGCCTTTTATAGG + Intronic
1131942022 15:97577284-97577306 AAATAATGCATGCTTTCCATGGG + Intergenic
1135791625 16:25401836-25401858 GATTACTGCCTGCATTCTATGGG + Intergenic
1137806914 16:51315687-51315709 CATTGATCCCTGCATTTTATAGG + Intergenic
1140672790 16:77295210-77295232 AATTGATTCATGGCTTCCATAGG - Intronic
1140950701 16:79814586-79814608 AATTAATTGATGCATTCTCTGGG + Intergenic
1142680271 17:1543515-1543537 AATTGAACCATGCTTTCTAAGGG - Intronic
1143824214 17:9591012-9591034 AAAAGATGCATGCAAACTATAGG - Intronic
1149395707 17:56240426-56240448 CATTCATTCATTCATTCTATTGG + Intronic
1156085876 18:33401524-33401546 TTTTGATGAATACATTCTATTGG - Intronic
1156199475 18:34813472-34813494 ATTTGTTGTATGCATTTTATGGG - Intronic
1159011788 18:63064836-63064858 AAGTGATCCATGCATTAAATTGG + Intergenic
1159541954 18:69789361-69789383 AATTAATGCTTGCATTATGTTGG + Intronic
1159562057 18:70006574-70006596 ACTTTATGTATGCATTCTAATGG - Intronic
1160471557 18:79139593-79139615 TTTTGATGCAGGCATTCAATGGG + Intronic
1164535061 19:29079537-29079559 AAATGACACATGCATTCCATGGG - Intergenic
925495171 2:4439972-4439994 AAATGATGCATGAATTTTAAAGG - Intergenic
927233197 2:20845418-20845440 AATTGATATAAGCATTCTAAAGG + Intergenic
927379441 2:22461661-22461683 CATTGATGCACACATACTATAGG + Intergenic
930673501 2:54176238-54176260 AAATAATGCATGCATTGTCTCGG + Intronic
936644561 2:114354199-114354221 ATTTGATGCCTGCATTACATGGG + Intergenic
936666791 2:114606257-114606279 ATTTTATGCCTGCATTTTATGGG + Intronic
936932139 2:117801068-117801090 AATGAATATATGCATTCTATAGG + Intergenic
936946743 2:117937785-117937807 AATAGATGAATGCATTTCATGGG - Intronic
938614279 2:132981307-132981329 ATTTGCTGCATGCCTTCTGTGGG - Intronic
939439239 2:142222138-142222160 AATAGATCCATAAATTCTATGGG + Intergenic
939698972 2:145365035-145365057 AATTAATACATGCTTTCTAGAGG + Intergenic
941389456 2:164893792-164893814 AAGTGATGCATGAATTATCTTGG + Intergenic
942440321 2:176028263-176028285 AAAAGATGCATGGGTTCTATTGG - Intergenic
942918003 2:181335840-181335862 ATTTGAAGCATGAATTCTCTGGG + Intergenic
943475623 2:188351567-188351589 TCTTGATCCATGCATTCTAGAGG + Intronic
944887117 2:204074448-204074470 AAGTTATGCATGCATGTTATGGG + Intergenic
945816622 2:214612789-214612811 ACTTGAAGCACGGATTCTATTGG - Intergenic
946424638 2:219587156-219587178 AATTGATTCATGCAGTGAATAGG + Intergenic
1169793081 20:9432120-9432142 CATTGATGCATATATTATATCGG - Intronic
1172944349 20:38675712-38675734 CATTCATTCATGCATTCTTTAGG - Intergenic
1173201579 20:40959052-40959074 AACAGATGCATGCATTCTCATGG - Intergenic
1173362242 20:42355158-42355180 AGTTGATGCATACATTCTCCAGG + Intronic
1174334636 20:49850632-49850654 AGTTGAAACATGCATTCCATCGG - Intronic
1176748593 21:10673106-10673128 ATTTAATGAATGCATTCTAATGG - Intergenic
1177540461 21:22486748-22486770 TTTTGATACATGCATACTATAGG + Intergenic
1179768327 21:43592291-43592313 AATTGATGCTTACATTGTATAGG + Exonic
1184527211 22:45031654-45031676 AATGGATTCAGGCATTCTAATGG + Intergenic
1184774045 22:46614630-46614652 AATTCATGAAAGCATTCTGTGGG + Intronic
950564793 3:13762188-13762210 AACTGAGGCATGGATACTATGGG - Intergenic
951736552 3:25872122-25872144 AATTAAAGCATGCATGCCATCGG - Intronic
952193768 3:31051071-31051093 AATGGATGCATGTATTAGATTGG + Intergenic
953999936 3:47548415-47548437 AATTCATCCATACATTCTTTTGG - Intergenic
955580600 3:60416505-60416527 AATTCATGTATGCATTGTCTGGG - Intronic
955791001 3:62588532-62588554 AATTGGTGCATGCACTTTAGGGG + Intronic
956423035 3:69104315-69104337 AATTGATGCAAGCTTTCAAATGG - Intronic
957676220 3:83368873-83368895 AATTGATGCATGTAGACCATTGG - Intergenic
958115882 3:89218068-89218090 AATTGATTCATGTATTGAATTGG + Intronic
959270282 3:104199227-104199249 ATTGGATTCATGCATTCTGTTGG - Intergenic
962945263 3:140163377-140163399 AATTGATTCATGCATTTTGTGGG - Intronic
962977327 3:140457029-140457051 AATTGAAGTGTGAATTCTATAGG + Intronic
963577882 3:147084537-147084559 AAGTGATATATGCAATCTATGGG + Intergenic
964556277 3:157942898-157942920 TATTGGTGCATGCATTCTGGAGG + Intergenic
964919233 3:161875663-161875685 AATTGTTCCATGCTTTCTACGGG - Intergenic
965616370 3:170596871-170596893 AACTTATGACTGCATTCTATTGG - Intronic
965912582 3:173797575-173797597 ATTGCATGCATGCATTGTATAGG - Intronic
968324463 3:197800776-197800798 AATTGATTTATCCATTCTACTGG - Intronic
972880279 4:43414596-43414618 TTTTGATACATGCATTCAATAGG - Intergenic
975196467 4:71530495-71530517 AATTGATTCCTGCCATCTATTGG + Intronic
980343016 4:131576463-131576485 CATTTATGCATGCTTTCAATGGG + Intergenic
980909902 4:138984529-138984551 AGTTGATACATTCATACTATGGG - Intergenic
982444037 4:155469343-155469365 AAATGATGCATCCAGCCTATTGG + Intergenic
982554886 4:156847980-156848002 AAATGATGCTGGCATACTATTGG + Intronic
984412524 4:179412650-179412672 AATTGATGTATGCATACAGTTGG - Intergenic
984442338 4:179788242-179788264 AAATGAAGAATGCATTCTGTAGG - Intergenic
984478838 4:180272952-180272974 AATTTCTGCTGGCATTCTATTGG - Intergenic
984810396 4:183791139-183791161 AATTGGTGCATGCATTTCTTGGG + Intergenic
985119551 4:186626568-186626590 CATTCATGCATTCATTCTGTGGG - Intronic
985815468 5:2125073-2125095 AATCGATGCATGTATAATATTGG + Intergenic
990068159 5:51744432-51744454 AATTGATAAATGTATTGTATTGG - Intergenic
990997479 5:61746877-61746899 AACTGATGCAGGGATTCTACGGG - Intronic
991274115 5:64823444-64823466 AATTGATGAAGCCAGTCTATAGG + Intronic
994573481 5:101544154-101544176 AATTAATGTATTCACTCTATAGG + Intergenic
995198489 5:109399935-109399957 AAATGAAGAATGCATTCTATGGG + Intronic
999590439 5:153139266-153139288 TATTGAAGCTTGCCTTCTATTGG - Intergenic
1000188350 5:158883045-158883067 AATGGCTGCAGGCATTTTATGGG - Intronic
1007272567 6:40649631-40649653 AAGTGATTCATCCATTCTAGAGG + Intergenic
1007793935 6:44332156-44332178 AATTGCTGGATGCATTTTCTGGG + Intronic
1008098256 6:47362263-47362285 AATTGATGAATACATTCAGTGGG - Intergenic
1009592992 6:65698393-65698415 AATCGATGCATTAATTATATAGG - Intronic
1012880183 6:104778089-104778111 AATTTCTGCATGTATTCTAAAGG - Intronic
1013916827 6:115349528-115349550 AATTCATCCATTCATTCAATTGG + Intergenic
1014151010 6:118055217-118055239 AATGGATACATGCATTCTTGAGG + Intronic
1014327842 6:120021200-120021222 AATAGATTCTTGCACTCTATAGG - Intergenic
1015619607 6:135117348-135117370 ATTTGTTGCAGGCAATCTATCGG + Intergenic
1016027039 6:139298392-139298414 CATTGCTGCATGCATTCTACAGG + Intergenic
1016310922 6:142732661-142732683 TATATGTGCATGCATTCTATTGG - Intergenic
1018413182 6:163576734-163576756 TATTGATACATGCATTTTCTGGG - Exonic
1021023253 7:15630772-15630794 AATTTATGAAATCATTCTATTGG + Intronic
1021384103 7:20007134-20007156 AATTAATGTATCCATTCTAAGGG - Intergenic
1022244375 7:28544123-28544145 ATTAGAAGCATGCAATCTATGGG - Intronic
1024960907 7:54974687-54974709 AATTTTTTCATGCATTCTTTTGG - Intergenic
1026588116 7:71674120-71674142 AATCAATACATACATTCTATCGG + Intronic
1031306931 7:120140032-120140054 ATTTGATGCATGAATAATATTGG + Intergenic
1032679993 7:134172556-134172578 AACTGGTGCATTCTTTCTATAGG - Intronic
1035877538 8:3207932-3207954 GAGTGATGCCAGCATTCTATTGG - Intronic
1037227224 8:16606954-16606976 CATTGATTCATCCATTCTTTTGG + Intergenic
1037228978 8:16631715-16631737 TGTTGATGCTTGCATCCTATAGG - Intergenic
1039271723 8:35888879-35888901 AATTGATGCCTGTGTTCTAGGGG - Intergenic
1041961423 8:63621435-63621457 AATTGAAGAGTGCATTCTGTAGG + Intergenic
1044982195 8:97727922-97727944 ACTTTATGCATGCATTTTATTGG + Exonic
1045845430 8:106629591-106629613 CATTAATGCATGTATGCTATTGG + Intronic
1046090334 8:109496090-109496112 AATTGGTGTATGCATTATCTTGG - Intronic
1047163642 8:122411063-122411085 AAGTGATGCCTGCATTCTTTGGG + Intergenic
1048561159 8:135538974-135538996 AATTCCTCCATGCATTCTATAGG - Intronic
1048756973 8:137750345-137750367 AATTGACAGATGGATTCTATTGG - Intergenic
1050042385 9:1509984-1510006 ACTTGATGCATGCATTGTTTTGG + Intergenic
1050317873 9:4421863-4421885 AGCTGATCCATGCATTCTAGGGG - Intergenic
1050347082 9:4701149-4701171 ACTTAAAGCCTGCATTCTATTGG + Intronic
1050766215 9:9137931-9137953 ACCTGATGCATGAATTCTTTTGG - Intronic
1051288177 9:15517495-15517517 TATTGCTTCGTGCATTCTATGGG + Intergenic
1051761791 9:20475109-20475131 AGTTGATTCATGCATTTTAAAGG + Intronic
1052069352 9:24063110-24063132 AATTTTTTCATCCATTCTATGGG - Intergenic
1052738036 9:32364724-32364746 AATTAATTAATACATTCTATTGG + Intergenic
1054973724 9:71118743-71118765 ATTTGATGAATGGATTCTCTAGG - Intronic
1055123874 9:72696058-72696080 AATTGATGTATGCATGATATAGG + Intronic
1055868750 9:80848174-80848196 GGATGATGCATGCATACTATAGG - Intergenic
1056065360 9:82928047-82928069 TATTTATGCATACATTATATAGG + Intergenic
1056431629 9:86533982-86534004 TATAGATGCATGCTTTCCATGGG - Intergenic
1057816237 9:98297678-98297700 AATTGATGAATACATGCTAATGG + Intronic
1186271526 X:7893415-7893437 AATTAATGCAAGGATACTATTGG + Intergenic
1186750381 X:12615602-12615624 AATGGATCCATTCATTCTATGGG + Intronic
1187139394 X:16577997-16578019 AGTTCAGGCATGCATTCTAAGGG + Intergenic
1187286339 X:17907615-17907637 AATCAATGAATGCATTCAATGGG + Intergenic
1188370975 X:29369349-29369371 AAAAGGTGCCTGCATTCTATTGG + Intronic
1194416740 X:93621699-93621721 AAGTGTAGCATGGATTCTATAGG + Intergenic
1194560962 X:95419700-95419722 AATTGATGTTTCCAGTCTATTGG - Intergenic
1196526420 X:116732533-116732555 AATTGATTCCTGCATGCTAGTGG - Intergenic
1198055931 X:132994803-132994825 ATTGTATCCATGCATTCTATTGG - Intergenic
1199754813 X:150854175-150854197 AGTTGAAGTATGCATTCTCTGGG - Intronic
1199853761 X:151743361-151743383 AATAGATGCAGGCATTCCAGTGG - Exonic
1201504400 Y:14681712-14681734 AATTGCTGCAAGCACTTTATTGG + Intronic