ID: 1110094700

View in Genome Browser
Species Human (GRCh38)
Location 13:71502520-71502542
Sequence ATTGATGCATGCATTCTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110094697_1110094700 -2 Left 1110094697 13:71502499-71502521 CCATGAAAGTACTACTTTTAAAT 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1110094700 13:71502520-71502542 ATTGATGCATGCATTCTATGGGG 0: 1
1: 0
2: 0
3: 17
4: 174
1110094696_1110094700 17 Left 1110094696 13:71502480-71502502 CCTTGTCGGAGCTGTTTAACCAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1110094700 13:71502520-71502542 ATTGATGCATGCATTCTATGGGG 0: 1
1: 0
2: 0
3: 17
4: 174
1110094695_1110094700 18 Left 1110094695 13:71502479-71502501 CCCTTGTCGGAGCTGTTTAACCA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1110094700 13:71502520-71502542 ATTGATGCATGCATTCTATGGGG 0: 1
1: 0
2: 0
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110094700 Original CRISPR ATTGATGCATGCATTCTATG GGG Intronic
904936132 1:34131006-34131028 ATAAATGCTTGCATTCAATGTGG + Intronic
908016438 1:59842409-59842431 ATGGATGCATGCATTGAATTTGG + Intronic
909957526 1:81798889-81798911 ACTGATGCATGCACTCATTGGGG + Intronic
914427093 1:147587347-147587369 ATTCATGCGTGCATTCTAGAAGG - Intronic
921988590 1:221339562-221339584 ATTGAGACATGATTTCTATGGGG - Intergenic
922112087 1:222569650-222569672 ATAGATGCTGGAATTCTATGGGG - Exonic
1066530103 10:36328221-36328243 ATGAATGCAGGCATACTATGAGG - Intergenic
1067053654 10:43039189-43039211 GGTGAAGCATGCATTCTATAGGG - Intergenic
1067717737 10:48702624-48702646 ATTTATTCATTCATTCTGTGAGG + Intronic
1068633871 10:59327012-59327034 ATTGATGGATGCATTTAATGTGG - Intronic
1070859986 10:79647132-79647154 ACTGATTAATTCATTCTATGAGG - Intergenic
1072210771 10:93244920-93244942 ATAGCAGCATTCATTCTATGTGG + Intergenic
1076728193 10:132423339-132423361 ATTGTAACATGCATTCCATGTGG + Intergenic
1078727045 11:13940989-13941011 CTTGATGCATGGATTCTGTAAGG - Intergenic
1081001904 11:37684201-37684223 ATTGATAAATTCATTCTATGAGG + Intergenic
1084412454 11:69012677-69012699 ATTCAAGCATGCATTCTAGAGGG - Intronic
1087096152 11:94320324-94320346 ATTGATGGATGCATTATAGAAGG + Intergenic
1087218078 11:95516412-95516434 ATTTATGTATGCATTCCATGTGG - Intergenic
1087630152 11:100640422-100640444 ATTGATGCATACATTTAATGTGG + Intergenic
1087887991 11:103502546-103502568 ATTGTTCCATGGATGCTATGAGG + Intergenic
1089178585 11:116565560-116565582 TTTGATGCATGCAGTGTAGGTGG - Intergenic
1089861743 11:121596297-121596319 GGTGATGCATGCATTCTCTACGG + Intronic
1092675890 12:10918605-10918627 ATTGGTGCATGCATTTTGTAGGG - Intronic
1093271017 12:17061891-17061913 ATAAATGCATGCATTCCAAGGGG - Intergenic
1094399447 12:30045634-30045656 ATTGATTCATGTGTTCTTTGAGG - Intergenic
1096034748 12:48456825-48456847 ATTGATGTGTGCATTTAATGTGG - Intergenic
1099622843 12:85026095-85026117 ATTAATGCTTGAATTATATGAGG + Intronic
1100337570 12:93646357-93646379 TTTGATGCATTCATTCTTTAAGG - Intergenic
1100447917 12:94678333-94678355 ATTGATGCATTCGGTCTCTGTGG - Intergenic
1100904270 12:99279548-99279570 ATGGAAGCATGCAATCTGTGGGG + Intronic
1102890548 12:116555424-116555446 ATGCATGCATGCAATCCATGTGG - Intergenic
1104677953 12:130728028-130728050 TTCGATGCTTGCATCCTATGTGG - Intergenic
1108273547 13:48786066-48786088 ATTGATCCATGCATTTCATTTGG - Intergenic
1108965809 13:56299938-56299960 CTTGATTCAGGCATTATATGTGG + Intergenic
1109937838 13:69315767-69315789 ACTTATGCATGTAATCTATGAGG + Intergenic
1110094700 13:71502520-71502542 ATTGATGCATGCATTCTATGGGG + Intronic
1112303704 13:98253907-98253929 TTTCATGCATGCTTTCCATGTGG + Intronic
1116297500 14:43131918-43131940 ATTCCTCAATGCATTCTATGAGG - Intergenic
1116595777 14:46842668-46842690 AGTAAGGCATGCATTCTAAGAGG - Intronic
1118379532 14:65206274-65206296 GTTGATGCATGCGTTTGATGTGG - Intergenic
1123936713 15:25197534-25197556 ATGGATGCATGCATGCGTTGTGG + Intergenic
1128413932 15:67426483-67426505 TTTGATACATGCATACAATGTGG - Intronic
1130670107 15:85904464-85904486 TTGGATAAATGCATTCTATGAGG + Intergenic
1131947461 15:97641848-97641870 ATTGATGCATGAAATTGATGAGG + Intergenic
1137491263 16:48934930-48934952 ATGGCTGCATGCATACTATTTGG + Intergenic
1137657693 16:50174502-50174524 TTTGATACATGCATACAATGTGG + Intronic
1137930759 16:52585107-52585129 ATTAAAGCATGCTTTCTTTGAGG - Intergenic
1138782136 16:59801581-59801603 TTTCATGCATGCATTCTTTCAGG - Intergenic
1140038213 16:71387485-71387507 ATAGATGCACGCATTCCATTTGG + Intronic
1140405571 16:74708791-74708813 ATGGATGCAGGCAGTCTATTTGG - Intergenic
1140950702 16:79814587-79814609 ATTAATTGATGCATTCTCTGGGG + Intergenic
1141851476 16:86649225-86649247 TTTGATGCCTCCATTCTATCAGG - Intergenic
1142680270 17:1543514-1543536 ATTGAACCATGCTTTCTAAGGGG - Intronic
1142897336 17:2990198-2990220 ATTCATGCATACATTTTCTGTGG + Intronic
1147516319 17:41121324-41121346 TTTTATGCATGCATTTAATGAGG + Intergenic
1148076071 17:44935851-44935873 ATTCATTCATTCAGTCTATGGGG - Intronic
1149037661 17:52153795-52153817 ATTATTGCATGCTTACTATGTGG + Intronic
1149227123 17:54485405-54485427 ATTGTTACATGTATTTTATGTGG - Intergenic
1149797978 17:59539243-59539265 AAGCATCCATGCATTCTATGAGG - Intergenic
1151637799 17:75363985-75364007 ATTGCTGCCTGTATTCTATTTGG + Intronic
1203171529 17_GL000205v2_random:152675-152697 ATTTATTTATTCATTCTATGAGG + Intergenic
1203174207 17_GL000205v2_random:180101-180123 ATTTATTTATTCATTCTATGAGG - Intergenic
1156199474 18:34813471-34813493 TTTGTTGTATGCATTTTATGGGG - Intronic
1156381819 18:36568501-36568523 ATTCATGCATGCAGTCTGTGTGG - Intronic
1161818094 19:6512430-6512452 CTTGATACATCCATTCTATCTGG - Intergenic
1164535060 19:29079536-29079558 AATGACACATGCATTCCATGGGG - Intergenic
928560277 2:32476127-32476149 TTTGATGTATGAATTCTGTGAGG + Intronic
928642530 2:33315378-33315400 TTTGATGCATACATGCTTTGAGG - Intronic
929271396 2:39976281-39976303 ATTGATCCATGCATTCACTCAGG + Intergenic
929549715 2:42881722-42881744 ATTGAGGGATGCATTTAATGTGG + Intergenic
934625454 2:95846031-95846053 ACTGATGCATGAATTCAATAAGG + Intronic
934808117 2:97255278-97255300 ACTGATGCATGAATTCGATAAGG - Intronic
934829393 2:97501909-97501931 ACTGATGCATGAATTCGATAAGG + Intronic
935552596 2:104474041-104474063 ATTGAAACATGCTTTCTATAAGG - Intergenic
935676119 2:105596243-105596265 ATTCATCCATGCATCCTCTGGGG + Intergenic
936546752 2:113396808-113396830 ACTGATGCATGAATTCAATAAGG - Intergenic
936665491 2:114590202-114590224 ATTGATGAAAGCATACTTTGAGG - Intronic
937165570 2:119812834-119812856 ATTGATGTCTTCAATCTATGAGG + Intronic
938225598 2:129613614-129613636 ATTGATGCAGGGATTCTGTGAGG + Intergenic
938620529 2:133047965-133047987 TTTGATGCATGCATTTTGTGAGG - Intronic
942918004 2:181335841-181335863 TTTGAAGCATGAATTCTCTGGGG + Intergenic
943877482 2:193089771-193089793 ATTTCATCATGCATTCTATGAGG + Intergenic
943931920 2:193865791-193865813 ATTGATTCATGCATGTTAAGTGG - Intergenic
944518123 2:200532682-200532704 ATTGTACCATGCATTCCATGAGG + Intronic
944887118 2:204074449-204074471 AGTTATGCATGCATGTTATGGGG + Intergenic
945854664 2:215054575-215054597 AGTGATGCATGCCTTCTTTCTGG + Exonic
945894023 2:215462385-215462407 ATTGATGCTTACATGCAATGAGG - Intergenic
946532637 2:220588893-220588915 TTTGATGTATGCAATGTATGTGG - Intergenic
947092183 2:226524327-226524349 ATTGATGCCTGCATTCTTCCTGG + Intergenic
1169495519 20:6111181-6111203 TTGGGTACATGCATTCTATGAGG - Intronic
1169555003 20:6740146-6740168 ACTGTTGCATGGATTCTATGTGG - Intergenic
1173031272 20:39362973-39362995 AGTGATTCTTTCATTCTATGTGG + Intergenic
1175016870 20:55801034-55801056 TTTGATACAAGCATACTATGTGG + Intergenic
1176327507 21:5514507-5514529 ATTTATTTATTCATTCTATGAGG + Intergenic
1176330197 21:5541743-5541765 ATTTATTTATTCATTCTATGAGG - Intergenic
1176397560 21:6279208-6279230 ATTTATTTATTCATTCTATGAGG + Intergenic
1176400250 21:6306444-6306466 ATTTATTTATTCATTCTATGAGG - Intergenic
1176436907 21:6682660-6682682 ATTTATTTATTCATTCTATGAGG + Intergenic
1176439597 21:6709896-6709918 ATTTATTTATTCATTCTATGAGG - Intergenic
1176461169 21:7009730-7009752 ATTTATTTATTCATTCTATGAGG + Intergenic
1176463859 21:7036965-7036987 ATTTATTTATTCATTCTATGAGG - Intergenic
1176484730 21:7391508-7391530 ATTTATTTATTCATTCTATGAGG + Intergenic
1176487420 21:7418744-7418766 ATTTATTTATTCATTCTATGAGG - Intergenic
1178335322 21:31737375-31737397 AGTGATACATGCCTTCTGTGAGG - Intergenic
1178769264 21:35487727-35487749 GTTAATGCATGCAGACTATGAGG + Intronic
1179297999 21:40080398-40080420 ACTGATGCTTGCATTTTGTGTGG + Intronic
1179768328 21:43592292-43592314 ATTGATGCTTACATTGTATAGGG + Exonic
1181584978 22:23848253-23848275 ACTGATGCCTGCATTCCTTGGGG - Intergenic
1182905535 22:33932591-33932613 ATTGATAAATGCCTTCTAAGAGG + Intergenic
1184975389 22:48057971-48057993 AGTGATGCATGAACTCTCTGAGG + Intergenic
953517653 3:43611672-43611694 TTTGTTGCATGCCTGCTATGTGG - Intronic
953803199 3:46044978-46045000 ATTTATGAACTCATTCTATGAGG + Intergenic
956809994 3:72855584-72855606 TTTGATGCATGTGATCTATGAGG - Intronic
957783470 3:84849363-84849385 ATTGAGGCTTGCATCCTCTGAGG + Intergenic
957946755 3:87073495-87073517 ATTCATGCATATCTTCTATGTGG + Intergenic
961971117 3:130969572-130969594 ATCTATGCATGGATTCTATAAGG - Intronic
962945262 3:140163376-140163398 ATTGATTCATGCATTTTGTGGGG - Intronic
963753894 3:149213248-149213270 GTTGATGCATGCAATGTGTGTGG + Intronic
970085561 4:12342264-12342286 ATTGAAATATTCATTCTATGTGG - Intergenic
971148604 4:24006867-24006889 GTTGAAGAATGCAGTCTATGTGG - Intergenic
971322374 4:25615883-25615905 ATTGCTGCATCCAATCTATTTGG - Intergenic
971584363 4:28386376-28386398 TTTGATACATGCATACAATGTGG + Intronic
975123132 4:70751033-70751055 ATTAATGCATACATTTTGTGTGG + Intronic
976137824 4:81957954-81957976 TTTGATGTATGCATACAATGTGG - Intronic
977654026 4:99501565-99501587 ATTTGTGCATGCATTTTAAGTGG - Intergenic
978378080 4:108096323-108096345 AGTGGTGCAAGGATTCTATGGGG + Intronic
980609585 4:135140702-135140724 GTGTATGCATGCATTCTGTGAGG - Intergenic
980624174 4:135350752-135350774 TTTGATGCATGCATAGAATGTGG - Intergenic
982325899 4:154127867-154127889 ACACATGCATGCATTTTATGTGG - Intergenic
984877554 4:184383065-184383087 ATTAATGCATGAATTTAATGTGG - Intergenic
987296391 5:16555922-16555944 ATTGACGCAAGCATGCTATTAGG + Intronic
987781593 5:22443665-22443687 ATTGATGCATACAACCTAAGTGG - Intronic
987867740 5:23567957-23567979 ATTTATTCATGCATTTTTTGTGG + Intergenic
991374876 5:65956287-65956309 ATGCATGCATGCATGCTATATGG - Intronic
991767608 5:70004168-70004190 ATTGATGAGTACATTATATGTGG - Intergenic
991846842 5:70879244-70879266 ATTGATGAGTACATTATATGTGG - Intergenic
993569257 5:89516317-89516339 ATTTTTACATGCATTCTAAGTGG + Intergenic
995006044 5:107196693-107196715 ATTCATGCTTGCATTTTATGAGG + Intergenic
995130721 5:108627692-108627714 AATTATCCATGCATTCTATATGG - Intergenic
996418340 5:123234099-123234121 ATTTATTCATGCATTCTACATGG - Intergenic
997916701 5:137933950-137933972 GTGGAAGCATGCAATCTATGAGG + Intronic
999056809 5:148586900-148586922 TTTCAGGCATGCATCCTATGAGG - Intronic
1001750469 5:174126542-174126564 ATTCATGCATGTCTTCCATGGGG + Intronic
1004825580 6:19417065-19417087 AATGAGGCATGCACTCTATGAGG + Intergenic
1006316355 6:33294052-33294074 ATTGATGTATCCATTCTGCGAGG + Exonic
1007793936 6:44332157-44332179 ATTGCTGGATGCATTTTCTGGGG + Intronic
1009056111 6:58337298-58337320 ATTGATTAAGGCATTCTAAGAGG + Intergenic
1013296246 6:108760702-108760724 ATTTCTGCATGCATTTTATGTGG - Intergenic
1013786211 6:113784325-113784347 ACTTATGCATGCATGCTATTTGG - Intergenic
1014627860 6:123751683-123751705 TTGGATGCATACATTATATGTGG - Intergenic
1015867900 6:137745853-137745875 ATTGATGTATCCATTTAATGTGG + Intergenic
1016027040 6:139298393-139298415 ATTGCTGCATGCATTCTACAGGG + Intergenic
1016543859 6:145198159-145198181 ATTGACGCATTCATAGTATGTGG + Intergenic
1016719467 6:147278198-147278220 ATTGATGCATTCTTACCATGTGG - Exonic
1018413181 6:163576733-163576755 ATTGATACATGCATTTTCTGGGG - Exonic
1018830691 6:167441068-167441090 ATTGATGTATACACTCAATGCGG + Intergenic
1020703744 7:11516227-11516249 ATTTATGTATGTATTTTATGAGG - Intronic
1020996198 7:15268469-15268491 ATGTATGCATGCATTCCATATGG + Intronic
1024847168 7:53659980-53660002 ACTGATGCATTGATTATATGTGG + Intergenic
1024915756 7:54497753-54497775 ATTAATGCAAGAAATCTATGTGG + Intergenic
1027979236 7:85196162-85196184 GTTAATGCATGCATTCTATTTGG - Intergenic
1028462429 7:91110325-91110347 ATTGATGAATTCCTTATATGAGG + Intronic
1028466993 7:91163530-91163552 TTTGATACATGCATACAATGTGG + Intronic
1028955231 7:96681996-96682018 ATTGATTCTTCCAATCTATGAGG + Intronic
1030773548 7:113504956-113504978 TTTCATGCATGCTTTCTATAAGG + Intergenic
1032676957 7:134139448-134139470 ATTGATGTTAGCATTCTCTGTGG + Exonic
1033920768 7:146388521-146388543 TTTGATGCAGGCATGCAATGTGG + Intronic
1034738171 7:153448163-153448185 TTTGATACATGCATACAATGTGG + Intergenic
1038179133 8:25210269-25210291 CTTGATGTGTGCATTCTAAGCGG + Intronic
1041967179 8:63692396-63692418 AATGCTGGATGCATTATATGTGG + Intergenic
1043508543 8:80926741-80926763 TGTGATGGATGTATTCTATGCGG + Intergenic
1044982196 8:97727923-97727945 CTTTATGCATGCATTTTATTGGG + Exonic
1045449315 8:102305581-102305603 ATTCATTTATGCATTGTATGTGG - Intronic
1047163643 8:122411064-122411086 AGTGATGCCTGCATTCTTTGGGG + Intergenic
1047600533 8:126421713-126421735 CTTGATGCATGGATTTTATTAGG - Intergenic
1048747296 8:137628657-137628679 ATTGATACATGCATATGATGTGG - Intergenic
1050317872 9:4421862-4421884 GCTGATCCATGCATTCTAGGGGG - Intergenic
1052600390 9:30620488-30620510 ATTGATAATTGCATTTTATGTGG + Intergenic
1055868749 9:80848173-80848195 GATGATGCATGCATACTATAGGG - Intergenic
1055923400 9:81485704-81485726 TTTGATGCAGGCATGCAATGTGG - Intergenic
1056431628 9:86533981-86534003 ATAGATGCATGCTTTCCATGGGG - Intergenic
1057428090 9:94970222-94970244 TTTGGTGCATGCATACCATGTGG + Intronic
1203431898 Un_GL000195v1:98583-98605 ATTTATTTATTCATTCTATGAGG + Intergenic
1203434604 Un_GL000195v1:126001-126023 ATTTATTTATTCATTCTATGAGG - Intergenic
1186986441 X:15019612-15019634 ATATATGGATTCATTCTATGTGG - Intergenic
1187139395 X:16577998-16578020 GTTCAGGCATGCATTCTAAGGGG + Intergenic
1191592193 X:62899586-62899608 ATTGATGAAAGTATTTTATGAGG - Intergenic
1193796215 X:85877667-85877689 ATTGATACAGGCATACAATGTGG - Intronic
1194132743 X:90102096-90102118 ATTGATTCTTGCTATCTATGAGG + Intergenic
1195234177 X:102880435-102880457 ATTGATGTATACATTTTCTGAGG - Intergenic
1199491465 X:148404974-148404996 TTTGATGCAAGTATTCTAGGAGG + Intergenic
1200478527 Y:3672175-3672197 ATTGATTCTTGCTATCTATGAGG + Intergenic