ID: 1110097446

View in Genome Browser
Species Human (GRCh38)
Location 13:71546110-71546132
Sequence AAGCTGATCTGTTTGACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110097446 Original CRISPR AAGCTGATCTGTTTGACATA TGG (reversed) Intronic
903194988 1:21679242-21679264 AATCTGCTTTATTTGACATAAGG + Exonic
907584265 1:55602687-55602709 ACCTTGAACTGTTTGACATATGG + Intergenic
907813394 1:57894564-57894586 AAGCCGATGTGCTTGACACATGG + Intronic
907978601 1:59458283-59458305 ACTGTGAGCTGTTTGACATAAGG + Intronic
909771524 1:79428684-79428706 AAGCTTATCTTGTTGACATGTGG - Intergenic
910904518 1:92160959-92160981 AAGTTGGGATGTTTGACATATGG + Intergenic
911733922 1:101316840-101316862 AATCTGACTTGTTTGACGTAAGG - Intergenic
911750282 1:101488583-101488605 AAGGAGATCTGTTTGACTTGAGG - Intergenic
912558725 1:110535096-110535118 AAGCTGCTCTGCTTGAATTAGGG + Intergenic
913353338 1:117887690-117887712 AAGCTCACCTGTTTGGTATAAGG + Exonic
914234109 1:145792515-145792537 AAACTAATCTTTTTGACATGAGG - Intronic
914976406 1:152367660-152367682 AAGCTGAGCTGCTTGTCAAATGG + Intergenic
919826052 1:201504060-201504082 AAGCTGATGTGTTTCACAAATGG + Intronic
921778254 1:219128336-219128358 AAGCTGAAATCTTTGACTTAAGG - Intergenic
923093887 1:230759728-230759750 CATCAGATCTGTGTGACATATGG + Intronic
923908991 1:238418522-238418544 AAGCTGATTTTTTTTAAATAAGG - Intergenic
924921153 1:248630591-248630613 AATTTTATCTGTTTAACATAAGG - Intergenic
1064939330 10:20715038-20715060 AGGCTGCTCTGTTTGCCACATGG + Intergenic
1070982236 10:80658985-80659007 AAGGTGATCTGTTTAACTCAAGG + Intergenic
1071752254 10:88493354-88493376 AAGATGATCTGTATGAGATGGGG - Intronic
1071886718 10:89959541-89959563 AATCTTATCTGTGTGACACATGG - Intergenic
1072976070 10:100059711-100059733 AAGTGGAACTGTTGGACATAAGG - Intronic
1073778741 10:106814205-106814227 AAGCTGAATTATTTTACATAAGG + Intronic
1074146047 10:110717998-110718020 CATCTGTTCTGTTTGACATGTGG + Intronic
1074700508 10:116087994-116088016 AAGCACATCTGTTTGACCTTGGG + Intronic
1075510476 10:123068227-123068249 AAGATGATCTGCATGACATTTGG + Intergenic
1080343556 11:31296222-31296244 AAACTCTTCTGTTAGACATAAGG - Intronic
1081396651 11:42593919-42593941 AAGCTAATCATTTTGCCATATGG + Intergenic
1082896611 11:58198128-58198150 CAGATGATCTTTTTCACATAAGG + Intergenic
1084400115 11:68938637-68938659 AATCTGGTCTGTTTGGCATAGGG + Intronic
1089681973 11:120123632-120123654 CAGCAGATCTGTTTGAGTTAGGG - Intronic
1093940071 12:25043313-25043335 AAGCTGAAATGTTGGACATGTGG - Intronic
1094751511 12:33414977-33414999 GAGCTGCTCTGGTTGACATGTGG + Intronic
1095230380 12:39732229-39732251 AACCTGTTCCATTTGACATATGG + Intronic
1103191549 12:119006178-119006200 GAGCTGCTCTGTCTGACATTTGG + Intronic
1103828397 12:123759438-123759460 AAATTCATCTGTTTGACATTTGG + Exonic
1109794105 13:67287436-67287458 GAGCAGATCTGACTGACATATGG + Intergenic
1110097446 13:71546110-71546132 AAGCTGATCTGTTTGACATATGG - Intronic
1112843310 13:103606571-103606593 AAGCTGCTCTACTTGAGATAGGG - Intergenic
1121972901 14:98375173-98375195 AAACTGATCTGTGTGACTGAGGG + Intergenic
1126049943 15:44676401-44676423 TTGCTGGTCTGTTTCACATATGG - Intronic
1126671775 15:51122044-51122066 AACCTGTTCCATTTGACATATGG + Intergenic
1127345084 15:58086912-58086934 AAGTTGATCTATTTGAAATAGGG - Intronic
1128654571 15:69451182-69451204 AAACTGATCTGGTTGACAAGTGG - Intergenic
1129291368 15:74570536-74570558 AAGCTGATCTCATTCACAGAAGG - Intronic
1133168865 16:3967923-3967945 AAGCTGATCACTTTGAGATCAGG - Intronic
1136285771 16:29240478-29240500 AAGATGATCTTTTTAACAAACGG - Intergenic
1137012510 16:35336803-35336825 AAGGAGATCTGTTTGAAAGAAGG + Intergenic
1137016801 16:35385007-35385029 AAGGAGATCTGTTTGAAAGAAGG + Intergenic
1138877539 16:60970943-60970965 ATGCTGATGTGTTGGACAAAGGG - Intergenic
1142091106 16:88210665-88210687 AAGATGATCTTTTTAACAAACGG - Intergenic
1149970144 17:61209841-61209863 AAGCTGTTCTATTAAACATAGGG - Intronic
1155013914 18:21813051-21813073 AAACTGATATGTTTGTCAAAAGG - Intronic
1156656472 18:39294445-39294467 AATCTGACCTGCTTGTCATATGG - Intergenic
1158913798 18:62098394-62098416 CAGTTAATCTGTTGGACATACGG + Intronic
1158939445 18:62393391-62393413 AATGTGAGCAGTTTGACATATGG + Intergenic
1159139871 18:64380715-64380737 AAGCTGATCTGTTTGATTTCTGG - Intergenic
1159889825 18:73943111-73943133 CAGCTGATTTTTTTCACATAAGG + Intergenic
928504632 2:31938118-31938140 ATTCTAATCTGTGTGACATAAGG - Intronic
928577679 2:32672156-32672178 TAACTTACCTGTTTGACATATGG - Intronic
929830435 2:45342731-45342753 AAGCTGATCTGTGGGAGACAAGG - Intergenic
930141009 2:47951527-47951549 CAGCTGATGTGATTGAAATATGG - Intergenic
930380084 2:50617002-50617024 AAGCTGACCTATTTGAAGTAGGG + Intronic
933424472 2:82092172-82092194 AAGCTACTCTGTTTATCATAGGG + Intergenic
936684961 2:114816906-114816928 AAGCTGACCTGTATGAAACAAGG + Intronic
939698652 2:145361001-145361023 AAGATGATCATTTAGACATAAGG + Intergenic
939868084 2:147497410-147497432 AAGCTGTCCCTTTTGACATAAGG + Intergenic
941472497 2:165905800-165905822 AACCTGACCTAATTGACATACGG + Intronic
942606496 2:177697298-177697320 CATTTGATCTGTTTGACAAATGG - Intronic
946503172 2:220271411-220271433 AAGCAGTTTTGTTTCACATAGGG - Intergenic
1170161963 20:13322456-13322478 AAACTGATCTGTTTGCAATATGG - Intergenic
1171293832 20:23999151-23999173 AAAATGATCTGCTTGAAATACGG + Intergenic
1183360580 22:37381046-37381068 ATGCTGAGCTGTGTGACATCAGG + Intronic
952569321 3:34695184-34695206 AGGCTAATGTGTTTGACCTAAGG - Intergenic
952672344 3:35985318-35985340 AAGCATAACTGTTTGAAATATGG - Intergenic
955688240 3:61564960-61564982 GCGCTTATCTGTTTGACATGAGG + Intronic
956813009 3:72882972-72882994 AAGATGATCTTTTTAACAAATGG + Intergenic
957525542 3:81374527-81374549 AACCTGAACTGTTTGATTTAAGG - Intergenic
957660950 3:83152105-83152127 AAGTTGATATATTAGACATACGG - Intergenic
957671529 3:83310082-83310104 AAACTTATCTTTTTGACATATGG - Intergenic
957674581 3:83350131-83350153 ACCCTGATCTCTTTGACATTTGG - Intergenic
959147992 3:102572725-102572747 AAGATGATCTTTTTAAAATATGG + Intergenic
960909521 3:122635146-122635168 AAGCCGTGCTGATTGACATATGG - Exonic
963079350 3:141376620-141376642 AAGGTGATGGGTTTTACATAAGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
969875072 4:10130437-10130459 AAGCTGCTCTGTTTCAGTTATGG + Intergenic
974273611 4:59686081-59686103 AAGCTGATCTGTCAGTCTTATGG + Intergenic
975499727 4:75071250-75071272 AAGCTGATCTTTCTGAGCTATGG - Intergenic
975615278 4:76239964-76239986 AAGATGATCTTTTTGACAAATGG - Intronic
979587482 4:122437963-122437985 AAGTTCATCTGTTAGACATTTGG + Intergenic
980093956 4:128470681-128470703 AATCTGACCTTTTTGACATGAGG - Intergenic
981057313 4:140376242-140376264 AAACTGATTTGTTTGACATATGG - Intronic
984722156 4:182983538-182983560 TAGCTGATCTTTTTTACATGTGG - Intergenic
987035835 5:14017422-14017444 AAGCTCATCTGATTGACATGGGG - Intergenic
988725343 5:33920890-33920912 AAGCTTATGTGGTTGGCATAAGG - Intergenic
990042982 5:51395146-51395168 GAGCTTATATATTTGACATATGG - Intergenic
990942879 5:61221036-61221058 AAGCTGATCTGATTCACACCTGG - Intergenic
991106263 5:62845645-62845667 AAGTTGACCTGTTGGAAATAGGG - Intergenic
992437277 5:76766880-76766902 TAGCTGGTCTGTTAGACAGAGGG - Intergenic
992656480 5:78915120-78915142 AACCAGATTTGTTTGACAAAAGG - Intronic
993153632 5:84193162-84193184 AAGATGATTTGTTTGCTATATGG + Intronic
996502433 5:124231480-124231502 AAGCTGAACTGTTAGACACTGGG - Intergenic
998883802 5:146673091-146673113 AAGCTCATCTGTCTGAGTTATGG + Intronic
1004800809 6:19145118-19145140 AAGCTGTTCTGTTAGATAAAAGG - Intergenic
1007910998 6:45513970-45513992 AGGCTGTTTTGTTTTACATAGGG + Intronic
1008897702 6:56576381-56576403 TAGCTGATCAGTCTGAAATACGG + Intronic
1012307108 6:97672324-97672346 TAACTGATCTGTTTTACTTAAGG - Intergenic
1012449789 6:99343137-99343159 AAGCAGATCTGTTTGTCACAGGG + Intronic
1013729706 6:113150317-113150339 TAGCACATCTGTTTGAAATATGG - Intergenic
1014271128 6:119337477-119337499 TAACTGATCTGTTGGACACATGG + Intronic
1016492448 6:144621812-144621834 AAGCTGATCTGTTTGGTTTATGG + Intronic
1017001599 6:150001132-150001154 GAGCTGATCTCTTTGCAATAGGG - Intergenic
1020236241 7:6357799-6357821 TAGCTGTTCTGTATGATATATGG + Intergenic
1023353167 7:39340139-39340161 AAATTGATCTCTTAGACATAGGG + Intronic
1024603318 7:51005774-51005796 AAGCTGATTTATTTGTCACATGG + Intergenic
1027502650 7:78973099-78973121 CAGCTGTTCTGATTGTCATAAGG + Intronic
1029323131 7:99782783-99782805 AAGCAGGTTTGTTTGAAATAGGG + Intronic
1030856822 7:114568527-114568549 AAGAAGATATGTTTGAAATATGG + Intronic
1031442801 7:121814038-121814060 AAGGGGATCTCTTTAACATAGGG - Intergenic
1032306944 7:130743080-130743102 AAGCTCATCTGTTTTTCATAAGG - Intergenic
1034068765 7:148162303-148162325 AGGCTGATATATTTGACATCTGG + Intronic
1035465887 7:159076288-159076310 AAGCTGATCTATCTTACTTATGG - Intronic
1037238861 8:16754141-16754163 AAGCTGTTTGGTTTCACATAAGG - Intergenic
1038196337 8:25371727-25371749 CAGCTGATTTGTTTTACATAAGG + Intronic
1038869178 8:31475104-31475126 AAGCTGCTCTGTTTCACAATAGG + Intergenic
1038946112 8:32361913-32361935 AAGCTAACCTGTGTGACATGAGG - Intronic
1038958431 8:32492314-32492336 CAGCTGACCTGTGTGACATTTGG + Intronic
1042911789 8:73835376-73835398 GAGCTGATCTGTGTGACCAATGG + Intronic
1047382692 8:124378180-124378202 AAGCTGATCAGGTTGCCATTGGG + Intergenic
1048379890 8:133856185-133856207 CAGCTGCTCTGTTGGAAATAGGG - Intergenic
1051377781 9:16421261-16421283 AAGCTGATCTTATTGTCACAAGG - Intronic
1054900685 9:70366004-70366026 AAGCTCATTTTTTTGACATATGG - Intergenic
1059226869 9:112680675-112680697 AAGCTGATATGTTTGCCTTCTGG - Intergenic
1186019632 X:5239675-5239697 AATATGATCTGTTTGTCTTAGGG - Intergenic
1189534367 X:41922564-41922586 AAGCTGCTCTGTTTCAAAAATGG + Intronic
1192597221 X:72423833-72423855 AATCTGAACTGTTTGACTTCTGG + Intronic
1195597640 X:106710770-106710792 AAGCTGATCTGGGTGCCTTAGGG + Intronic
1197730297 X:129804091-129804113 AAGCTTCTCTGTCTGACCTAAGG + Exonic
1198992425 X:142530168-142530190 AAGCAGATCTGTCATACATATGG - Intergenic