ID: 1110100833

View in Genome Browser
Species Human (GRCh38)
Location 13:71598962-71598984
Sequence CTAACTTTTTTAAAGTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 511}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110100830_1110100833 22 Left 1110100830 13:71598917-71598939 CCTAGTTATTTTTATATTTTGTT 0: 1
1: 2
2: 27
3: 494
4: 6893
Right 1110100833 13:71598962-71598984 CTAACTTTTTTAAAGTGTCTAGG 0: 1
1: 0
2: 0
3: 36
4: 511
1110100829_1110100833 23 Left 1110100829 13:71598916-71598938 CCCTAGTTATTTTTATATTTTGT 0: 1
1: 0
2: 25
3: 177
4: 2422
Right 1110100833 13:71598962-71598984 CTAACTTTTTTAAAGTGTCTAGG 0: 1
1: 0
2: 0
3: 36
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110100833 Original CRISPR CTAACTTTTTTAAAGTGTCT AGG Intronic
901946021 1:12704474-12704496 CAAACTTTTTTAACATGTCTTGG + Intergenic
902258231 1:15204776-15204798 CTAAATTGTGTAAAGTGCCTGGG + Intronic
903401648 1:23056605-23056627 CTAATTTTTTAAAAGAGTATGGG + Intronic
904569738 1:31454137-31454159 CAAACTTCTTTAACATGTCTTGG + Intergenic
904571188 1:31466628-31466650 CAAACTTTCTTAATATGTCTTGG - Intergenic
904711724 1:32435104-32435126 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
905060427 1:35135277-35135299 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
905283750 1:36865884-36865906 CTTTCTTTTTTAAAGTGACAGGG + Intronic
905717574 1:40165872-40165894 CCAACTTTTTTAATGAGGCTGGG - Intronic
906081005 1:43088269-43088291 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
906506596 1:46384294-46384316 CAAACTTCTTTAACATGTCTTGG + Intergenic
906708619 1:47912996-47913018 CTGACTGATTTCAAGTGTCTGGG + Intronic
907292719 1:53427058-53427080 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
907900972 1:58741155-58741177 CTTACTTTCTTAAAATTTCTGGG + Intergenic
908521944 1:64952555-64952577 AACACTTTTTCAAAGTGTCTAGG + Intronic
908832831 1:68197817-68197839 TAAATTTTTTTAAAGTGTGTGGG + Intronic
909776587 1:79491512-79491534 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
909788174 1:79641675-79641697 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
909792894 1:79699308-79699330 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
909978352 1:82070461-82070483 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
910049486 1:82958106-82958128 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
910474708 1:87594558-87594580 CTTACTTTTTAAAAATATCTTGG - Intergenic
911768719 1:101711838-101711860 CTAACATATTTAAAGTGCTTAGG - Intergenic
913717471 1:121551411-121551433 ATAACATTTTTAAAGTATATGGG - Intergenic
915700312 1:157785953-157785975 CTAATTTTATTAAATTGTTTGGG - Intergenic
916700171 1:167284583-167284605 CTATATTTTTTAAAGTTTCTTGG - Intronic
916712425 1:167423665-167423687 TTAACTTTTTGACAGTGTCCTGG - Exonic
918563891 1:185903156-185903178 CTAGTTATTTTAAAGTGTCAAGG - Intronic
919645833 1:200093854-200093876 CTAAATTTTTAAAAATTTCTTGG + Intronic
919871954 1:201828761-201828783 CCAACTTTTTTTCAGTGTTTGGG + Intergenic
921353379 1:214261043-214261065 TTGACATTTTTAAAGGGTCTGGG + Intergenic
924180747 1:241436732-241436754 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
924703472 1:246478154-246478176 TTAATTTTTTTAAATTGTTTTGG - Intronic
924781704 1:247155465-247155487 CTACCCATTTTAAAGTGTGTTGG - Intronic
1063905944 10:10780331-10780353 CTATCTTCTTTAAAATGCCTAGG - Intergenic
1064059073 10:12122214-12122236 CTTACTATTTTTAACTGTCTGGG + Exonic
1064756655 10:18577588-18577610 CAAACTTCTTTAACATGTCTTGG - Intronic
1065333069 10:24624284-24624306 CTAATTATTTTAAAATCTCTGGG - Intronic
1065691428 10:28337981-28338003 CTATCCATTTTAAAGTGTGTTGG - Intergenic
1066511852 10:36108457-36108479 TTAATTTTTTTAAAATGTCTTGG + Intergenic
1067138829 10:43637309-43637331 CTAACATTTTTGAAATGTTTAGG - Intergenic
1067159441 10:43811249-43811271 ATAATTCATTTAAAGTGTCTAGG + Intergenic
1067356174 10:45529689-45529711 CTAACTTTTTAAATGTTTCTTGG - Intronic
1067658340 10:48214612-48214634 AAAACTTTTTTTAAGTGTTTAGG + Intronic
1067838932 10:49660685-49660707 TTAAATTTATTAAAATGTCTAGG + Intronic
1068749698 10:60577739-60577761 TTAAGTTTTATAAAATGTCTTGG + Intronic
1068943669 10:62706279-62706301 CTTACTTTATTAAATTTTCTGGG - Intergenic
1069297902 10:66869836-66869858 CTAACATTTCTAAAATGCCTTGG - Intronic
1069362835 10:67663037-67663059 TTCACTTTTTCGAAGTGTCTTGG + Intronic
1070069693 10:73075622-73075644 CTAACATTTTGAAAATGTATTGG - Intronic
1070887036 10:79910223-79910245 CTCTCTTGTTTAAAGTGTATTGG + Intergenic
1071908594 10:90203845-90203867 CTATCTTTTTTATAGTGCCTAGG - Intergenic
1071961212 10:90810187-90810209 ATAATTTAGTTAAAGTGTCTTGG - Intronic
1072391481 10:94991955-94991977 CAAACTTCCTTAAAATGTCTTGG + Intergenic
1073553412 10:104425099-104425121 CTAACTGATTTAAACTGCCTAGG + Intronic
1074033514 10:109713671-109713693 CCAACTTTTTCAAAGTGATTTGG + Intergenic
1075322514 10:121503522-121503544 TTATCATTTTTTAAGTGTCTGGG - Intronic
1077765359 11:5153699-5153721 ACAACTTTATTGAAGTGTCTAGG - Intronic
1077766290 11:5163231-5163253 ATAATTTAGTTAAAGTGTCTCGG + Intronic
1077825513 11:5804644-5804666 CAAACGTTTTTAACATGTCTTGG + Intronic
1077850700 11:6072783-6072805 GTAATTTAGTTAAAGTGTCTCGG + Intergenic
1078879607 11:15435215-15435237 TTAACTTTTTTAAAGTATAATGG - Intergenic
1079726988 11:23890137-23890159 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1079847594 11:25490169-25490191 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1079902637 11:26206461-26206483 CTAATTTTTTGACATTGTCTAGG - Intergenic
1081953037 11:47062422-47062444 CTAACTTTTCTATATTGTATAGG + Intronic
1083145317 11:60753831-60753853 ATAACTTATTTGAAGTGCCTAGG + Intergenic
1083868810 11:65474034-65474056 CCAATTTTTTTTAAATGTCTTGG + Intergenic
1084226838 11:67721093-67721115 CAAATATTTTTAAAATGTCTCGG + Intergenic
1084808353 11:71595761-71595783 CAAATATTTTTAAAATGTCTCGG - Intronic
1084812489 11:71622375-71622397 CAAATATTTTTAAAATGTCTCGG - Intergenic
1084845459 11:71895770-71895792 CAAATATTTTTAAAATGTCTCGG - Intronic
1086019531 11:82210013-82210035 CTAACTTTTTTAAAGCTTAATGG + Intergenic
1086125218 11:83343039-83343061 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1086136171 11:83445848-83445870 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1086550305 11:88045947-88045969 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1086795322 11:91093971-91093993 CTCACTTTTTTCACCTGTCTTGG - Intergenic
1086987757 11:93268574-93268596 CAAACTTTTTAAACATGTCTTGG - Intergenic
1087127907 11:94644368-94644390 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1087155638 11:94899274-94899296 TTAACTTATATAAAATGTCTAGG + Intergenic
1087639861 11:100745299-100745321 CAAACTTCTTTAACATGTCTTGG + Intronic
1087658673 11:100959204-100959226 CTAATTTTTTTAAAGGGTTTTGG - Intronic
1090526719 11:127545679-127545701 ATAATTTAGTTAAAGTGTCTTGG + Intergenic
1090926844 11:131257440-131257462 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1090956409 11:131516672-131516694 GTAACTTTTTTAAAGGGTCAGGG - Intronic
1091133186 11:133164121-133164143 GCAACTTTTTAAAAGTGACTTGG - Intronic
1091501178 12:1019423-1019445 CTCACATTTTAAAAATGTCTTGG - Intronic
1092739231 12:11612656-11612678 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1094400776 12:30058742-30058764 ATAATTTAGTTAAAGTGTCTGGG - Intergenic
1094432807 12:30388566-30388588 CTAGCTTTTGTATAGTGTCCTGG - Intergenic
1094642469 12:32289300-32289322 CTAACTTTTTTCAGTTATCTTGG + Intronic
1096147189 12:49286817-49286839 CTTAACTTTTTAAAGAGTCTAGG + Intergenic
1096858379 12:54503157-54503179 CTGACATTTTTGAAGAGTCTGGG + Intronic
1097128676 12:56793949-56793971 CTGACATTTTTAAAGAGTGTGGG + Intergenic
1097515421 12:60598522-60598544 GTAACTTTTTAAAATTTTCTAGG + Intergenic
1097787223 12:63774153-63774175 TTTACTTTTTAAAATTGTCTTGG - Intergenic
1098402351 12:70088166-70088188 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1098629937 12:72711847-72711869 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1099188814 12:79542626-79542648 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1099292005 12:80786030-80786052 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1099541283 12:83911400-83911422 CTTATTTTTTTAAATTGACTAGG + Intergenic
1100066885 12:90658551-90658573 ATAACTTTTTTAAAATTTGTGGG + Intergenic
1100463198 12:94821099-94821121 CTTTCTTTTTGAAAGTGCCTGGG + Intergenic
1100902332 12:99256314-99256336 CTAAAGTTTTTAAATTGTTTAGG - Intronic
1101351988 12:103938678-103938700 CTAACTTTTATATATTGCCTAGG + Intronic
1101726868 12:107395245-107395267 CTAACATTGTCAAAGGGTCTAGG + Intronic
1102606603 12:114072577-114072599 CAAACTTGTTTAACATGTCTTGG - Intergenic
1104203323 12:126613471-126613493 CAAACTTTTTAAACATGTCTTGG + Intergenic
1104356701 12:128093176-128093198 CTAACATGGTTAAAGAGTCTAGG - Intergenic
1105200904 13:18175949-18175971 CTAACTAATATAAAGTGTTTTGG - Intergenic
1105225858 13:18430905-18430927 CAAACCTTTTTAACATGTCTTGG - Intergenic
1105679334 13:22709479-22709501 CTAACTTTCTTGATATGTCTGGG - Intergenic
1105986792 13:25575350-25575372 CTAACTTTTTAAAATTGTACTGG - Intronic
1106343835 13:28857012-28857034 CTCACTTCCTTAGAGTGTCTGGG - Intronic
1106785053 13:33099111-33099133 CTAACTTTTTAAATATTTCTAGG + Intergenic
1107053269 13:36075504-36075526 TTCTCTTTTTTAAATTGTCTGGG - Intronic
1107220203 13:37972123-37972145 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1107546474 13:41438137-41438159 CAAATATTTTTAAAATGTCTCGG + Intergenic
1107626997 13:42298174-42298196 CTAACTATTATAAATTGTTTGGG - Intronic
1108202789 13:48059157-48059179 GTAATTTAGTTAAAGTGTCTCGG - Intronic
1108513092 13:51172629-51172651 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1108803776 13:54130636-54130658 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1108814226 13:54269622-54269644 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1108919451 13:55657921-55657943 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1108964797 13:56284656-56284678 CTAACTTTTTTTAAGGTTCAGGG + Intergenic
1109436625 13:62311745-62311767 TTGAATTTTTCAAAGTGTCTCGG - Intergenic
1109469134 13:62781222-62781244 CTAAGTTCTTTACAATGTCTTGG + Intergenic
1109588606 13:64444438-64444460 GTAACTTTTTTACGGTGTCTAGG + Intergenic
1109773898 13:67014672-67014694 CTGACTTCTTTACAGTTTCTTGG + Intronic
1109839571 13:67904556-67904578 CAAATATTTTTAACGTGTCTCGG - Intergenic
1109864714 13:68247852-68247874 CTAACTTATTAGAAATGTCTAGG + Intergenic
1109909283 13:68889279-68889301 CAAACTTTTTAAACATGTCTTGG + Intergenic
1109948698 13:69472609-69472631 CTAATTTTTTTAAAGATTCTAGG - Intergenic
1110100833 13:71598962-71598984 CTAACTTTTTTAAAGTGTCTAGG + Intronic
1110650397 13:77936275-77936297 ATAATTTAATTAAAGTGTCTCGG + Intergenic
1110765576 13:79276894-79276916 ATAATTTAGTTAAAGTGTCTTGG - Intergenic
1111259758 13:85721689-85721711 CAAAATTTTGTAAAGTGTATTGG - Intergenic
1111752458 13:92350835-92350857 CTAAACTTTTTGAATTGTCTTGG - Intronic
1112601865 13:100864189-100864211 TTATCTTTTTTAAAATTTCTGGG + Intergenic
1112737178 13:102433621-102433643 CTAACTGTTTTTAAGAGTTTTGG + Intergenic
1113717060 13:112517948-112517970 GTAACTATTTTAAATTGTTTAGG + Intronic
1114010311 14:18359253-18359275 CAAACCTTTTTAACATGTCTTGG - Intergenic
1114223298 14:20716105-20716127 CAAACCTTTTTAACATGTCTTGG + Intergenic
1114290458 14:21283820-21283842 CTAACTTTTGTCATGTGGCTGGG + Intergenic
1114907910 14:27153004-27153026 GTAATATTTTTAAAGTGTGTAGG + Intergenic
1115387103 14:32810521-32810543 CTATGTTTTTTAACGTGTCTAGG + Intronic
1116573545 14:46546680-46546702 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1116613609 14:47106947-47106969 ATAATTTAGTTAAAGTGTCTCGG - Intronic
1117009697 14:51458016-51458038 TTAACCTTTTTAAGGTGCCTTGG + Intergenic
1117039773 14:51759325-51759347 CTAATGTTTTTAAAATGTCTCGG - Intergenic
1117672450 14:58122741-58122763 CAATCTTTTTTAAAGTGTCCTGG - Intronic
1119022514 14:71127086-71127108 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1120437963 14:84503163-84503185 ATAATTTAGTTAAAGTGTCTTGG + Intergenic
1120598391 14:86469897-86469919 ATAACTTTTGTAATGTGTTTTGG - Intergenic
1124571077 15:30864478-30864500 TTAAATTTTTTGAAGTCTCTTGG + Intergenic
1125013309 15:34904505-34904527 CAAACTTTTTCAAATTGTCCAGG - Exonic
1126530059 15:49702087-49702109 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1126616811 15:50591226-50591248 CTTTCACTTTTAAAGTGTCTTGG + Intronic
1126617499 15:50600127-50600149 TTCACTTTTTTATATTGTCTAGG - Intronic
1128176827 15:65563660-65563682 CTAAATTTTTTTAAGAGTCAAGG - Intronic
1129638385 15:77347613-77347635 AAAATTTTTTTAAAGTCTCTGGG - Intronic
1131447840 15:92514272-92514294 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1131684271 15:94753535-94753557 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1131900593 15:97083751-97083773 CTTAATCTTTTAAAGTTTCTAGG - Intergenic
1132263110 15:100443053-100443075 ATAATTTAGTTAAAGTGTCTCGG - Intronic
1133861847 16:9603125-9603147 TTAACTTTCTTAAATTTTCTTGG - Intergenic
1133927766 16:10207104-10207126 CTAAGTTTTTTAAATTATCATGG + Intergenic
1133961148 16:10494627-10494649 CAAACTTCCTTAACGTGTCTTGG - Intergenic
1134401179 16:13911391-13911413 CTAACTTTTTTATTTTGTCTTGG - Intergenic
1135258394 16:20960336-20960358 CTAACTTTATGCAAGTGTCTCGG - Intronic
1137331439 16:47501278-47501300 CTGACATTTTTAAAGAGTCCAGG - Intronic
1138235558 16:55379643-55379665 ATAAGTTTTTTAAGGTCTCTTGG - Intergenic
1138581586 16:57944992-57945014 TTAACTTTTTAAAAGAGCCTAGG + Intronic
1138868637 16:60852680-60852702 CTTAATTTTTTGAAGGGTCTGGG - Intergenic
1138898525 16:61240335-61240357 TTTATTCTTTTAAAGTGTCTTGG - Intergenic
1139028500 16:62850146-62850168 CAAACTTTATAAAAGAGTCTTGG + Intergenic
1139074219 16:63423812-63423834 TTAACATTTTTAAGGGGTCTTGG + Intergenic
1139094496 16:63688789-63688811 TTAACTTTTTGAAAGAGTTTGGG - Intergenic
1139943630 16:70623741-70623763 ATAATTTAGTTAAAGTGTCTCGG + Intronic
1140086572 16:71802425-71802447 CAAAATTTTTTAAAGTAGCTGGG - Intronic
1140542755 16:75773787-75773809 TTAATTTTTTAAAAATGTCTGGG - Intergenic
1141085351 16:81090520-81090542 CTACCTTTTTAAAAGTGTTTAGG - Intronic
1144510803 17:15874385-15874407 CTTATTTTTTAAAAGTGTCGTGG + Intergenic
1150463196 17:65370344-65370366 CTACCTCATTTAAAGTCTCTTGG + Intergenic
1151006139 17:70438228-70438250 CTCATGTTTTTAAGGTGTCTGGG - Intergenic
1151272309 17:73006421-73006443 TTTACATTTTTAAAGGGTCTTGG + Intronic
1151622580 17:75255336-75255358 ATAATTTAGTTAAAGTGTCTCGG - Intronic
1154527518 18:15308614-15308636 CAAACCTTTTTAACATGTCTTGG + Intergenic
1155173918 18:23286817-23286839 ATAATTTAGTTAAAGTGTCTCGG - Intronic
1155202664 18:23530930-23530952 CTAAGGGTTTTAAAGGGTCTGGG + Intronic
1155569342 18:27174277-27174299 CTGACATTTTTGAAGTGTCCAGG + Intronic
1156237453 18:35218531-35218553 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1156251840 18:35359261-35359283 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1156302342 18:35846687-35846709 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1156923956 18:42555439-42555461 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1156958275 18:42993641-42993663 ATAATTTAGTTAAAGTGTCTTGG - Intronic
1158047083 18:53169261-53169283 GTTACTTGATTAAAGTGTCTTGG - Intronic
1158219144 18:55132059-55132081 CTGTATTTTTTAAAATGTCTAGG + Intergenic
1158394550 18:57069574-57069596 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1159047231 18:63380895-63380917 TTAACTTTTTTGAAGAGACTGGG + Intergenic
1159291206 18:66423519-66423541 CTAATTTTTGTAAGTTGTCTTGG - Intergenic
1159523016 18:69549995-69550017 TTAACATTTCTAAAGTATCTTGG - Intronic
1159644141 18:70897652-70897674 CTATATTTTTTCAATTGTCTTGG + Intergenic
1162268376 19:9594666-9594688 ATAACTTTTTTGAAATGTCTAGG + Intergenic
1162626031 19:11885938-11885960 TAAACTTTTTTAACGTGTTTTGG - Intergenic
1163487387 19:17596193-17596215 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1164003708 19:21130758-21130780 ATAATTTTGTTAAAATGTCTTGG - Intergenic
1164003998 19:21132728-21132750 ATAATTTTGTTAAAATGTCTTGG + Intergenic
1164789370 19:30963033-30963055 TTAAATTTTTTACAGTTTCTTGG + Intergenic
1165138032 19:33683048-33683070 CTGACTGTTTAAAAGAGTCTAGG - Intronic
1165561270 19:36682111-36682133 ATAAATTTTTTAAATTGTCTGGG + Intergenic
1166264387 19:41669201-41669223 TTAACATTTTTAAAGAGTATCGG - Intronic
1166927055 19:46276274-46276296 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1167652999 19:50743402-50743424 CTGACTGTTTAAAAGAGTCTGGG + Intergenic
1167907048 19:52669914-52669936 CAAACTTCTTTAACATGTCTTGG - Intronic
926503422 2:13681925-13681947 CAAACTTGTTTAACATGTCTTGG - Intergenic
926644662 2:15276506-15276528 CTGCCTATTATAAAGTGTCTTGG + Intronic
928712279 2:34020504-34020526 CTAACTCTTTTAAATAGTCCAGG - Intergenic
928770728 2:34700039-34700061 ATAACTTAGTTAAAGTGTCTTGG + Intergenic
928857266 2:35815848-35815870 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
930490948 2:52071041-52071063 CTGACATTTTCAAATTGTCTAGG + Intergenic
930766452 2:55090269-55090291 CTCTCTGTTTTAAACTGTCTTGG - Intronic
930955193 2:57195722-57195744 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
931042709 2:58316457-58316479 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
931126068 2:59277923-59277945 CTCAATTTTTTAATGTTTCTTGG - Intergenic
931157439 2:59651580-59651602 CTAAGTTTTAAAAAATGTCTAGG - Intergenic
931608844 2:64078127-64078149 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
931948352 2:67334364-67334386 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
932295942 2:70623394-70623416 ATAATTTAGTTAAAGTGTCTCGG - Intronic
932367550 2:71162633-71162655 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
933054471 2:77644284-77644306 CTAATGTTTTTGAAGTGTTTTGG + Intergenic
933163813 2:79054138-79054160 GTAATTTAGTTAAAGTGTCTCGG - Intergenic
933432671 2:82204226-82204248 CTAATTTTCTTATAGTGTCTTGG - Intergenic
933552299 2:83791853-83791875 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
933631092 2:84659354-84659376 CTTACTTTTTTAATATGACTGGG - Intronic
933950850 2:87328046-87328068 ATAACTATTAAAAAGTGTCTTGG - Intergenic
936328925 2:111530532-111530554 ATAACTATTAAAAAGTGTCTTGG + Intergenic
936747351 2:115593309-115593331 CTAGCTTTTCTAGAGTTTCTAGG + Intronic
936794197 2:116187213-116187235 ATAATTTAGTTAAAGTGTCTTGG + Intergenic
937553695 2:123128300-123128322 GTATCTTATTTAAAGTGACTTGG - Intergenic
937642934 2:124234547-124234569 CCAAGTTTTTTAAAATGCCTGGG + Intronic
937892704 2:126951068-126951090 CTTACCTTATTACAGTGTCTAGG + Intergenic
938526614 2:132140072-132140094 CAAACCTTTTTAACATGTCTTGG + Intergenic
939893477 2:147764815-147764837 CTAGCTTATTTAACGTGGCTTGG - Intergenic
939944371 2:148391101-148391123 CTAGGTTTATTAAAGAGTCTTGG - Intronic
940530278 2:154870078-154870100 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
940621067 2:156114514-156114536 CAAAGTTTTTTAAAATGACTTGG + Intergenic
940675711 2:156723012-156723034 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
940835069 2:158511972-158511994 CTCAGTTTTTTAAAGTGTTATGG + Intronic
940870464 2:158855924-158855946 CAAATATTTTTAAAATGTCTCGG - Intronic
941497666 2:166226704-166226726 CTAACTTTTGTAAATTTTATAGG - Exonic
942730196 2:179054703-179054725 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG + Intergenic
943461107 2:188172151-188172173 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
943835486 2:192510237-192510259 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
943900066 2:193422391-193422413 CTCACTTTCTTAAAGGTTCTAGG + Intergenic
944823793 2:203459358-203459380 CTGAATTTTGTAAAATGTCTAGG + Intronic
944876030 2:203964863-203964885 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
945173545 2:207020010-207020032 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
945361733 2:208902000-208902022 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
946029804 2:216694916-216694938 CTACATTTTTGCAAGTGTCTGGG - Exonic
946780949 2:223192783-223192805 ATAATTTATTTAAAGTGTCTCGG + Intronic
946904210 2:224400837-224400859 GTAACTTTTTTACAGCTTCTTGG - Intronic
1168822515 20:784878-784900 CAAACTTTTTAAACATGTCTTGG + Intergenic
1169322595 20:4645653-4645675 AGGACTTTTTTAAATTGTCTTGG + Intergenic
1170106330 20:12756640-12756662 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1170165838 20:13359725-13359747 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1170263066 20:14433829-14433851 CTAACTATTTTAAATCCTCTGGG - Intronic
1173346197 20:42202346-42202368 CTAATTTTTTTAAGTTGGCTCGG + Intronic
1176184342 20:63770051-63770073 CTCACTCTTTTAAAGAGTCAAGG - Intronic
1176769913 21:13059929-13059951 CAAACCTTTTTAACATGTCTTGG - Intergenic
1177100716 21:16894926-16894948 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1177119658 21:17124256-17124278 ATAACTTAGTTAAAATGTCTTGG - Intergenic
1177187299 21:17812008-17812030 CTAACTTTATTAGGGTGTCTAGG - Intronic
1178072696 21:28986517-28986539 TGAACTTTTTTAAAGTGCTTTGG - Intronic
1178837322 21:36109827-36109849 CAAACTTCTTTAACATGTCTTGG - Intergenic
1179225698 21:39451253-39451275 TTAACTATTTTAAAGTGCTTGGG - Intronic
1179354436 21:40645863-40645885 ATAAATTATTTAAACTGTCTTGG + Intronic
1180434807 22:15290054-15290076 CAAACCTTTTTAACATGTCTTGG - Intergenic
1180582230 22:16849546-16849568 CTAGATATTTTAAAGTGTCAGGG + Intergenic
1180737492 22:18028736-18028758 TTTACTTTTTTAAAGAGTCAGGG + Intergenic
1182203950 22:28603926-28603948 CTAATTTTATTTAAGTGTATTGG + Intronic
1184063959 22:42104989-42105011 CAAACCTTTTTAAGATGTCTTGG + Intergenic
949161999 3:893615-893637 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
949251754 3:1993467-1993489 CTAAATTCTCTAAAGAGTCTAGG - Intergenic
949827538 3:8179773-8179795 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
950690874 3:14656392-14656414 TTAACGTTTTTAAAGGGTCCAGG + Intronic
950926591 3:16747079-16747101 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
951298726 3:20970455-20970477 ATAATTTACTTAAAGTGTCTCGG + Intergenic
951316227 3:21192144-21192166 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
951333689 3:21395499-21395521 CTAATTTTTATAAAATTTCTGGG - Intergenic
951354657 3:21649831-21649853 TTAAATTATTTAAAGTGTATTGG + Intronic
952663371 3:35877273-35877295 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
952895958 3:38079223-38079245 ATAATTTAGTTAAAGTGTCTCGG + Intronic
954090208 3:48278258-48278280 CAAACTTTTTAAACATGTCTTGG - Intronic
954531225 3:51321569-51321591 CTAACCTTTTTCAAGGTTCTTGG - Intronic
955729924 3:61974111-61974133 CTGTCTTTTTTAGAGTGTGTTGG + Intronic
956709308 3:72025755-72025777 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
957012195 3:75020037-75020059 CTAACTTTTGTGAATTGACTTGG + Intergenic
957155015 3:76535599-76535621 ATAATTTGTTTAAAATGTCTCGG + Intronic
957191261 3:77012706-77012728 CTGAATTTTTAAAAGTGTATTGG - Intronic
957429766 3:80088039-80088061 CTTAATTTTTTAAAGTCTCCTGG + Intergenic
957785468 3:84876538-84876560 CTTTCTTTTTTAAATTGTCCAGG + Intergenic
959549010 3:107632416-107632438 TTTAGTTTTTGAAAGTGTCTAGG + Intronic
960127090 3:114011725-114011747 CTAACATTTATAAAGTTTCCAGG - Intronic
960579085 3:119258805-119258827 CTGACATTTTTGAAGTGTATGGG - Intergenic
960866550 3:122206620-122206642 TTAATTTTTTTGAAGTGTTTGGG + Intronic
961322718 3:126088269-126088291 CTTACATTTTTAAAGTTACTAGG - Intronic
961711528 3:128832135-128832157 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
961881134 3:130062030-130062052 ATAATTTAGTTAAAGTGTCTTGG - Intergenic
962613206 3:137098437-137098459 CAAACTTTTTAAAAATGTGTAGG - Intergenic
963520529 3:146356314-146356336 ATAATTTAGTTAAAGTGTCTTGG - Intergenic
963767907 3:149356843-149356865 ATATATTTTTTAAAGTGCCTGGG + Intergenic
964115259 3:153130172-153130194 TTAAGTTTATTAAAGTGTCTTGG + Intergenic
964125363 3:153229636-153229658 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
964301575 3:155292417-155292439 GTAATTTTTTTGAACTGTCTAGG + Intergenic
964524831 3:157607226-157607248 CTATGTTTTTTAAAGGTTCTTGG - Intronic
965555364 3:170012858-170012880 CTAAATCTTTTATTGTGTCTGGG + Intergenic
965624794 3:170675470-170675492 ATAATTTAGTTAAAGTGTCTCGG + Intronic
965713506 3:171579181-171579203 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
965857891 3:173111106-173111128 ATAACTTACTTAAAGTGTCATGG - Intronic
966066924 3:175830468-175830490 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
966085521 3:176064102-176064124 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
966154524 3:176901721-176901743 CTAACTGTTTTAAACTCTTTTGG - Intergenic
966405515 3:179593323-179593345 CTATTTTTTTTAAAGTCTCAGGG - Intronic
966803880 3:183790581-183790603 TTAAATTTTTTAAATTTTCTTGG + Intronic
967152213 3:186660781-186660803 ATAATTTAGTTAAAGTGTCTCGG - Intronic
967496319 3:190147267-190147289 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
967643731 3:191898302-191898324 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
967740570 3:192998449-192998471 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
968865785 4:3210397-3210419 ATAACTTGTTTCTAGTGTCTTGG + Intronic
968987890 4:3887941-3887963 CAAATATTTTTAAAATGTCTCGG + Intergenic
969003721 4:4003161-4003183 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
969023527 4:4155124-4155146 CAAATATTTTTAAAATGTCTCGG + Intergenic
969789888 4:9486069-9486091 CAAATATTTTTAAAATGTCTCGG - Intergenic
970087634 4:12366529-12366551 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
970092484 4:12426304-12426326 CAAACTTCTTTAATATGTCTTGG + Intergenic
970122636 4:12774076-12774098 CTAATATTTTTAAAGTGCATAGG + Intergenic
970256329 4:14173473-14173495 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
970668987 4:18374493-18374515 CTAACTTTTAGAAACTGTTTTGG + Intergenic
972076709 4:35099224-35099246 CTGTCTTTTCTTAAGTGTCTAGG + Intergenic
972309474 4:37866542-37866564 CCGAGTTTTTTAAAGTCTCTAGG + Intergenic
972754648 4:42033300-42033322 GTAACTGTTTTAAAGTTTTTGGG + Intronic
972785197 4:42320094-42320116 CAAACTTCTTTAACATGTCTTGG - Intergenic
974187388 4:58461126-58461148 CAATCTTTTTTGAAGTGTCCTGG - Intergenic
974544256 4:63279763-63279785 CTAATTCTGTTAAAATGTCTTGG - Intergenic
974785207 4:66610115-66610137 CTACTTTCTTTAAAGTGTCTGGG + Intergenic
974796654 4:66761212-66761234 CATCCTTTTTTAAAATGTCTTGG - Intergenic
975184650 4:71387394-71387416 CTGTCATTTTTAAAGTATCTAGG + Intronic
975267679 4:72390257-72390279 CTAACTTTAAAAAAGTCTCTGGG + Intronic
976558653 4:86477349-86477371 ATAATTTAGTTAAAGTGTCTTGG - Intronic
976884477 4:89967744-89967766 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
977108913 4:92925242-92925264 CTTACTTTTTTAAAGTCCCATGG - Intronic
978608244 4:110506335-110506357 ATAACATTTTTCAAATGTCTGGG + Intronic
978883309 4:113735016-113735038 TTTACTTTTTTAAAATGTCTTGG - Intronic
979147167 4:117258467-117258489 CTAAATTTTTTAATGTAACTAGG + Intergenic
979307547 4:119164653-119164675 ATAACATTTTTAAAGTATCAAGG - Intronic
979777662 4:124611483-124611505 CTAACCATTTCAAAGTGCCTAGG - Intergenic
980003263 4:127514398-127514420 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
980472350 4:133266639-133266661 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
980575538 4:134680859-134680881 ATAATTTGGTTAAAGTGTCTCGG + Intergenic
980655754 4:135783123-135783145 CTTATTTTTTAAAAGTGTTTTGG - Intergenic
980904030 4:138930627-138930649 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
980952858 4:139398825-139398847 CTAGCTTTTTTAGCCTGTCTTGG + Intronic
981040337 4:140216257-140216279 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
981076415 4:140596883-140596905 CAAACTTTTTTAACAAGTCTTGG + Intergenic
981425603 4:144599344-144599366 TTAAAATCTTTAAAGTGTCTAGG + Intergenic
981651080 4:147059785-147059807 CTTAATTCTTTAAAGTCTCTTGG - Intergenic
982083878 4:151815560-151815582 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
982626211 4:157769629-157769651 CTAACATATTTAAAATGTCAGGG - Intergenic
983046012 4:162986701-162986723 CAAACTTTATTAAAGTGGATTGG - Intergenic
983452427 4:167925653-167925675 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
983732980 4:171020981-171021003 CTGACTTTTGTAAACTGTCATGG - Intergenic
983805703 4:171988978-171989000 ATAATTTAGTTAAAGTGTCTCGG + Intronic
984098954 4:175464387-175464409 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
984437353 4:179723208-179723230 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
984493307 4:180464201-180464223 TTAATATTTTTAAAGGGTCTTGG - Intergenic
984723267 4:182996670-182996692 ATAATTTTTTTAAAGTATCCAGG + Intergenic
985435807 4:189928617-189928639 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
985797839 5:1976753-1976775 CTAGCTTTTCTCAAGTGGCTGGG + Intergenic
986388972 5:7266347-7266369 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
987215448 5:15732104-15732126 CTAAATTTTATACCGTGTCTGGG - Intronic
987487592 5:18541073-18541095 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
987621263 5:20340472-20340494 CAATCCTTCTTAAAGTGTCTTGG - Intronic
987641675 5:20620233-20620255 ATAACTTTTTTAAAGTAACATGG + Intergenic
988046459 5:25962050-25962072 CCAATTGTTTAAAAGTGTCTGGG + Intergenic
989192387 5:38683916-38683938 CCATATTTTTTAAAGTGACTTGG + Intergenic
989961092 5:50416374-50416396 GTAACATTTTTAAAGTATATGGG + Intronic
990946648 5:61256326-61256348 CCATCTTTATTAAAGTGTATAGG + Intergenic
991012432 5:61898250-61898272 GTAACTTTTTGAAATTGTCCCGG - Intergenic
992416202 5:76554090-76554112 CTACCTTTGTTGAACTGTCTTGG - Intronic
992960920 5:81956017-81956039 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
993054824 5:82969653-82969675 CAAACTTCTTTAACATGTCTTGG + Intergenic
993380133 5:87197322-87197344 CTAATTTTTTTATGGTGACTAGG - Intergenic
994490212 5:100432670-100432692 GTTACTTTTTTCCAGTGTCTTGG + Intergenic
994557018 5:101317695-101317717 ATAACTTAGTTAAACTGTCTTGG - Intergenic
994775772 5:104034371-104034393 GTAATTTAGTTAAAGTGTCTCGG - Intergenic
995071932 5:107933066-107933088 GGAACTTTTTTAAAGTGACATGG - Intronic
995558578 5:113356207-113356229 CTAAGTTTTTTATAGAGACTGGG + Intronic
995964277 5:117885221-117885243 CTAACTTCTTTACTGTCTCTAGG + Intergenic
996101349 5:119448771-119448793 CAAACTTCTTTAACATGTCTTGG - Intergenic
996377205 5:122823899-122823921 CAAACTTTATTAAAATGTCATGG + Intronic
996528138 5:124499813-124499835 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
997029505 5:130109152-130109174 TTAACGGTTTTAAAGTTTCTTGG - Intronic
997148100 5:131459716-131459738 CTAATTTTTTTAATTTATCTTGG - Intronic
997542486 5:134674997-134675019 GTAACTTTTATTAAGTGTGTAGG - Intronic
998552275 5:143089156-143089178 TTAAACTTTTTAACGTGTCTTGG + Intronic
998673959 5:144386321-144386343 CTAACTTTATGAAAGTATTTGGG - Intronic
998738245 5:145167849-145167871 CTAAACTTTTTAAAGTTTCTTGG - Intergenic
999412466 5:151364223-151364245 CTTAATTTTTTAATGTTTCTAGG + Intergenic
1000438674 5:161242731-161242753 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1000439811 5:161251256-161251278 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1000519319 5:162278347-162278369 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1000935547 5:167300839-167300861 ATAACTTAGTTAAAGTGTCTCGG + Intronic
1001352469 5:170982101-170982123 CTAAGAGTTGTAAAGTGTCTAGG - Intronic
1002456958 5:179350771-179350793 GTAATTTTTTTAAAGTTTGTTGG + Intergenic
1003938283 6:10998056-10998078 CTAATTGTTTGAAAGAGTCTGGG + Intronic
1003997528 6:11557914-11557936 CTATTTTTTTTAAAGTGACAGGG + Intronic
1004106348 6:12670132-12670154 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1004507901 6:16261940-16261962 ATAATTTAGTTAAAGTGTCTCGG + Intronic
1004575318 6:16888711-16888733 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1004768479 6:18757017-18757039 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1010043354 6:71413019-71413041 CTAATATTTATAAAGTGTTTAGG + Intergenic
1010150329 6:72724113-72724135 CTAATTATTTTAGAGAGTCTTGG + Intronic
1010568475 6:77448332-77448354 CTAGTTTGTTTAATGTGTCTTGG + Intergenic
1010787644 6:80023266-80023288 TAAACATTTTTAAAGTTTCTTGG - Intronic
1012689667 6:102295690-102295712 ATAATTTAGTTAAAGTGTCTTGG - Intergenic
1012941943 6:105424717-105424739 CTAACTCTTTTTAAGGATCTGGG - Intergenic
1013119065 6:107125415-107125437 AAAACTGTTTTAATGTGTCTGGG - Intergenic
1013364222 6:109423438-109423460 CTATCCATTTTAAAGTGTGTTGG + Intronic
1013407794 6:109858712-109858734 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1013637745 6:112045149-112045171 CTGACTTTTTTAAAGGCCCTTGG + Intergenic
1014612179 6:123559390-123559412 ATAATTTAGTTAAAGTGTCTCGG - Intronic
1014614578 6:123585241-123585263 ATAATTTAGTTAAAGTGTCTCGG + Intronic
1014944676 6:127483075-127483097 CTAACTCTTTTTATTTGTCTTGG - Intronic
1015516006 6:134083223-134083245 CTATATTTTTAAAAGAGTCTGGG + Intergenic
1016114051 6:140260395-140260417 ATAATTTGGTTAAAGTGTCTCGG + Intergenic
1016492212 6:144618593-144618615 CTCATTTTTTTAAAGTTTCTTGG - Intronic
1016535666 6:145106101-145106123 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1016853365 6:148642563-148642585 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1017255803 6:152331841-152331863 CTAACTTTTTCAAAGCTTCCAGG + Exonic
1017779250 6:157703603-157703625 ATAATTTAGTTAAAGTGTCTCGG + Intronic
1018084403 6:160289523-160289545 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1018495302 6:164341687-164341709 ATAATTTAGTTAAAGTGTCTTGG + Intergenic
1019356348 7:581879-581901 CTAACTTTTTAAAAATTTTTTGG + Intronic
1020316139 7:6906542-6906564 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1020745615 7:12074850-12074872 CAAACCTTTTTAACATGTCTTGG - Intergenic
1021220498 7:17970242-17970264 CTCAATTTTTGAAACTGTCTGGG + Intergenic
1021659217 7:22902634-22902656 TTATTTTTTTTAAAGTGTCAAGG + Intergenic
1022060650 7:26790674-26790696 CTAAGTTTTTTAAAGTATCCGGG + Intronic
1022572703 7:31469977-31469999 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1022709161 7:32835134-32835156 ATAATTTAGTTAAAGTGTCTTGG - Intergenic
1022733246 7:33051873-33051895 CAAGATTTTTTAAAGTGTGTTGG - Intronic
1023436131 7:40142382-40142404 CAAACTTCTTTAACATGTCTTGG + Intronic
1023595057 7:41820784-41820806 CTAAATTTCTTAAATTGTTTTGG + Intergenic
1024141541 7:46467467-46467489 CTGTCCTTTTTAAATTGTCTTGG + Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1028564534 7:92214535-92214557 ATAACATTTTTAAACTTTCTTGG + Intronic
1028566453 7:92237759-92237781 CTAACTTTTTAAAAATGATTAGG - Exonic
1028690264 7:93642619-93642641 ATAATTTAGTTAAAGTGTCTCGG - Intronic
1028793905 7:94882845-94882867 CAAACTTCTTTAACATGTCTTGG - Intergenic
1028892615 7:96005355-96005377 CTCTCTTTTAGAAAGTGTCTAGG - Intronic
1029661953 7:101968364-101968386 CTGCTTTTGTTAAAGTGTCTGGG + Intronic
1029792628 7:102861321-102861343 TTGACTTTTTTTAAGGGTCTAGG + Intronic
1030920908 7:115385267-115385289 CAAACGTTCTTAAAGTCTCTTGG + Intergenic
1031355100 7:120780091-120780113 ATAATTTAGTTAAAGTGTCTTGG + Intergenic
1031364667 7:120888568-120888590 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1031376531 7:121033492-121033514 TTAATATTTTTAAAGTGTGTAGG - Intronic
1031519618 7:122747640-122747662 GTAACTTTCTTAAATTCTCTGGG - Intronic
1032425191 7:131816958-131816980 CTTCCTTTTTCAAAATGTCTTGG - Intergenic
1033766617 7:144499725-144499747 CTTACTTTCTTAATCTGTCTTGG + Intronic
1034084739 7:148313000-148313022 ATAATTTAGTTAAAGTGTCTCGG + Intronic
1034118374 7:148604724-148604746 CTGTTTATTTTAAAGTGTCTTGG - Intronic
1035880575 8:3241163-3241185 ATAATTTAGTTAAAGTGTCTCGG + Intronic
1036070832 8:5439588-5439610 ATAATTTAGTTAAAGTGTCTTGG + Intergenic
1036639576 8:10574031-10574053 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1040589304 8:48775184-48775206 CAAACCTTTTTAAAGTGAGTTGG - Intergenic
1040944137 8:52864671-52864693 CTAACATTCTTAAGGTTTCTGGG - Intergenic
1040966920 8:53091988-53092010 TGAACTTTTTCAAGGTGTCTTGG + Intergenic
1041489632 8:58418467-58418489 TTGACTTTTTTAGAGAGTCTAGG + Intronic
1042491463 8:69403481-69403503 GTAACAATTTTAAAGTGTCCAGG + Intergenic
1043378518 8:79677428-79677450 ACAACTTTTTTTAAGTGTCTGGG + Intergenic
1043543159 8:81285743-81285765 TTTACTTTTTTAATGTTTCTAGG + Intergenic
1043837818 8:85065731-85065753 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1044572697 8:93737303-93737325 TTACCTTTTTTAAAATTTCTTGG + Exonic
1044761658 8:95523833-95523855 CTCACTTTTGTAATTTGTCTTGG - Intergenic
1045429170 8:102097188-102097210 CTCACTTTTTAAAAATGTTTAGG - Intronic
1045857871 8:106784746-106784768 TTAGTTTTTTTAGAGTGTCTTGG - Intergenic
1045901121 8:107281476-107281498 CTTATTTTTTAAATGTGTCTAGG + Intronic
1046294211 8:112198586-112198608 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1046347463 8:112951180-112951202 CTAACTTCATTTAATTGTCTTGG - Intronic
1046901689 8:119530362-119530384 CCAAATCTTTTAAAGTTTCTGGG + Intergenic
1047857602 8:128928560-128928582 CAAACTTTTTAAATGTGGCTTGG - Intergenic
1048135554 8:131743483-131743505 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1048764148 8:137827774-137827796 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1049868728 8:144957211-144957233 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1050258013 9:3814116-3814138 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1050582149 9:7070337-7070359 CTAATTTTTTAAAAGTGTTTAGG - Intronic
1050788342 9:9433225-9433247 CAAACTTCTTTTAAGTGTATCGG - Intronic
1051018384 9:12509554-12509576 CTAATTTTTATAAAGTATTTTGG + Intergenic
1051953319 9:22661518-22661540 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1052191919 9:25671685-25671707 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1054807396 9:69407699-69407721 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1055268352 9:74525908-74525930 CTAAATTTTTTAAAGTATAGGGG + Intronic
1055347623 9:75354732-75354754 ATAATTTAGTTAAAGTGTCTTGG + Intergenic
1056324892 9:85468899-85468921 ATAACTTTTTTAAAGTGATTTGG + Intergenic
1056414268 9:86361206-86361228 CAAACTTTTTAAACATGTCTTGG + Intergenic
1057982178 9:99672922-99672944 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1058112101 9:101041955-101041977 CTAACATCTTTTAAGAGTCTAGG - Intronic
1058569540 9:106325872-106325894 ATAACTTATTTTAAATGTCTTGG - Intergenic
1058612486 9:106790960-106790982 ATAATTTAGTTAAAGTGTCTTGG - Intergenic
1059307359 9:113364963-113364985 TTAACATTTTTAAAGAGTCAAGG + Intronic
1059546084 9:115177571-115177593 ATAATTTAGTTAAAGTGTCTCGG + Intronic
1059574706 9:115476108-115476130 ATAATTTAGTTAAAGTGTCTTGG - Intergenic
1059649894 9:116306215-116306237 CTAACTCTTGTACAGTGACTAGG - Intronic
1059856668 9:118406189-118406211 CCAGCTCTTTTAAAGTTTCTTGG - Intergenic
1059958938 9:119546397-119546419 CACCCTTTTTTAAAGTGTCCAGG - Intergenic
1060469857 9:123939302-123939324 CTAACATTTTGAAAGTGTGTTGG + Intergenic
1060737790 9:126077575-126077597 ATAATTTAGTTAAAGTGTCTTGG + Intergenic
1185960601 X:4543430-4543452 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1185991152 X:4894346-4894368 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1186642417 X:11470204-11470226 CTGACATTTTGAAAGTATCTGGG - Intronic
1186784163 X:12942598-12942620 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1187086433 X:16047638-16047660 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1187099877 X:16182117-16182139 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1187310278 X:18135198-18135220 CTAGCTTGCTTAAAGTGTGTTGG + Intergenic
1187771917 X:22708300-22708322 CTAAATTATTTAAAGTGCCTGGG - Intergenic
1187953997 X:24497586-24497608 CATACTTTTTAAAAGTCTCTGGG - Intronic
1188162103 X:26816798-26816820 GGAAATTTTTTAAAATGTCTTGG - Intergenic
1190422966 X:50304085-50304107 CTAACCTTTCTTAATTGTCTTGG + Intronic
1190599600 X:52076812-52076834 TTAAATTTTTTATAGTGACTGGG - Intergenic
1190609224 X:52177261-52177283 TTAAATTTTTTATAGTGACTGGG + Intergenic
1191889750 X:65927815-65927837 CAAACTTCTTTAACATGTCTTGG + Intergenic
1192313918 X:70037389-70037411 CTAACTCCTATAAAGTGCCTCGG + Exonic
1193356102 X:80521629-80521651 CTGATTTTTTTTAAGTGTTTTGG - Intergenic
1193975187 X:88109655-88109677 CTCAAATTTTGAAAGTGTCTTGG + Intergenic
1194873709 X:99162382-99162404 ATAATTTAGTTAAAGTGTCTCGG + Intergenic
1194938044 X:99974841-99974863 GTAAGTTATTTAACGTGTCTAGG - Intergenic
1196470301 X:116016455-116016477 CTGACTGTTTAAAAGTGTCTGGG - Intergenic
1196751445 X:119121188-119121210 CTTTCTTTTTTAAAGTGTGGTGG + Intronic
1196775032 X:119330643-119330665 GTTACTTTTCTAAAGTGTCCAGG - Intergenic
1197280399 X:124528952-124528974 TTAACATTTCTAAAGTGTCTAGG + Intronic
1197324287 X:125072956-125072978 GTAACTTTTTTTAATTCTCTGGG - Intergenic
1197933175 X:131714832-131714854 ATAATTTAGTTAAAGTGTCTCGG - Intergenic
1198408176 X:136337423-136337445 ATAATTTTTTTAAAGAATCTTGG - Intronic
1198763832 X:140061469-140061491 TTACTTTTTTTAAAGAGTCTGGG + Intergenic
1199278972 X:145977228-145977250 CAAACTTCTTTAACATGTCTTGG - Intergenic
1199453645 X:148002137-148002159 CTTACTTTTTTATGGTGTTTGGG - Intronic