ID: 1110101094

View in Genome Browser
Species Human (GRCh38)
Location 13:71603823-71603845
Sequence ATTTACATGGAGCATAATAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110101094_1110101097 30 Left 1110101094 13:71603823-71603845 CCGATATTATGCTCCATGTAAAT 0: 1
1: 0
2: 3
3: 16
4: 222
Right 1110101097 13:71603876-71603898 TTTATTACAAAGGAGAATAAAGG 0: 1
1: 0
2: 6
3: 45
4: 639
1110101094_1110101096 20 Left 1110101094 13:71603823-71603845 CCGATATTATGCTCCATGTAAAT 0: 1
1: 0
2: 3
3: 16
4: 222
Right 1110101096 13:71603866-71603888 TTATTGTTTCTTTATTACAAAGG 0: 1
1: 0
2: 2
3: 91
4: 875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110101094 Original CRISPR ATTTACATGGAGCATAATAT CGG (reversed) Intronic
900833793 1:4984739-4984761 ATATACATGCAGCATAATTATGG + Intergenic
901349563 1:8581862-8581884 ATTTACATGAAACAAAATATTGG + Intronic
904229672 1:29057704-29057726 ATTAAGAGGGAGCATAATAGAGG - Intronic
907651684 1:56301164-56301186 ATTTACTTGTAGAATAATCTTGG + Intergenic
907996760 1:59640784-59640806 ATTTACTTGGAAATTAATATTGG - Intronic
908867510 1:68567475-68567497 TTTTACATAGATAATAATATTGG - Intergenic
909746950 1:79109071-79109093 ATATAGTTGGAGCAGAATATAGG + Intergenic
911779404 1:101857201-101857223 ATTTACCTAGAACATAATATAGG + Intronic
913047618 1:115088068-115088090 ATTTACATCAAGCATACTATAGG - Intronic
914761476 1:150602285-150602307 ATTTACATGTAGAAATATATGGG - Intronic
916125139 1:161563346-161563368 ATTTACTTGAAGCATGATTTTGG + Intergenic
916507131 1:165438254-165438276 ATTTCCTTTGAGCATGATATTGG - Intronic
917213498 1:172655019-172655041 ATTTATATGGAGGACAAAATAGG - Intergenic
917820595 1:178759612-178759634 ATTTCCATGAAGAATATTATTGG + Intronic
918137883 1:181692309-181692331 ATTTACATGGAGCTAAAAAAGGG + Intronic
918494064 1:185113969-185113991 ATGCACATCAAGCATAATATAGG + Intergenic
918604857 1:186411136-186411158 ATTTCCTTTGAGCATCATATCGG - Intronic
918950809 1:191134610-191134632 ATTTGCATGGAGAAAAAGATGGG + Intergenic
919060628 1:192627923-192627945 GTTTACATAGAGCATGAAATGGG - Intergenic
920769977 1:208874892-208874914 CCTTACATAGAGCACAATATGGG + Intergenic
920862850 1:209724703-209724725 GTTTACATAGAGCAGAACATAGG + Intronic
922278192 1:224098820-224098842 ATTTTAATGGAGGATAATAAGGG - Intergenic
924440988 1:244085168-244085190 ATGAATATGTAGCATAATATGGG + Intergenic
1063273859 10:4541949-4541971 ACTTACATGGAGCAGAATCCAGG - Intergenic
1064524401 10:16238985-16239007 ATGTACATGGGTCAAAATATTGG - Intergenic
1064690965 10:17918073-17918095 ATTTACATGGTTGTTAATATAGG - Intergenic
1064705172 10:18064728-18064750 ATTTCCTTGGAGCATCATGTTGG - Intergenic
1064705436 10:18068267-18068289 ATTTAAATGGAGCATGATATGGG + Intergenic
1064865650 10:19876372-19876394 ATATACATGCAGCATAATGTGGG - Intronic
1064888713 10:20143433-20143455 ATATACATGCAGCAAAAAATAGG - Intronic
1066030546 10:31418855-31418877 ATTTCCTTTGAGCATCATATTGG - Intronic
1067401898 10:45983581-45983603 ACTTACATGAAGCATAAAAATGG - Intronic
1067870251 10:49953182-49953204 ACTTACATGAAGCATAAAAATGG - Intronic
1068344209 10:55750322-55750344 ACTTACATGGAACTTAATGTAGG + Intergenic
1068482787 10:57615297-57615319 GTTTACATGTTGCATAAAATGGG - Intergenic
1069369306 10:67729197-67729219 AATTACATGGAGAATAATTCTGG - Intergenic
1074025497 10:109629520-109629542 ATTTACATCTAAAATAATATAGG - Intergenic
1074949379 10:118314816-118314838 ATTAAAATGCAGCAAAATATTGG - Intronic
1079490120 11:20979431-20979453 ATTTACATGGAAGATAACATGGG - Intronic
1080907482 11:36561160-36561182 ATTCACTTGGAGCACAATGTGGG + Intronic
1081096113 11:38937853-38937875 ATTAAGATGGAGCATGATAGAGG + Intergenic
1081116515 11:39208597-39208619 CTTTACAACGAGCATAACATTGG + Intergenic
1085367815 11:75968069-75968091 ATTTTCCTTGAGCATCATATTGG + Intronic
1086767899 11:90721934-90721956 ATTTACATGAAAAATAATATTGG + Intergenic
1086999056 11:93394135-93394157 ATTTTCATGGAGAAAAAAATTGG - Intronic
1088317730 11:108524515-108524537 AGTTACATGGTACATAAAATAGG + Intronic
1090982875 11:131738812-131738834 ATTTACATTCAACATATTATAGG - Intronic
1094059270 12:26296312-26296334 ATTTACATGGGGAATAATGATGG - Intronic
1094068036 12:26382306-26382328 ATTAACATGGAGCATCTTCTGGG - Intronic
1094415843 12:30214050-30214072 ATTTTCCTGGAGGATAGTATGGG + Intergenic
1095751366 12:45715315-45715337 ATATATATTGAGCATTATATTGG + Intergenic
1097764538 12:63510405-63510427 ATTCACATGCAGAATAAAATTGG + Intergenic
1097835411 12:64268032-64268054 ATTTACTTTGAGCATCATGTTGG + Intronic
1098346616 12:69511605-69511627 ATTTACATGGAGATGAATAGAGG + Intronic
1101073453 12:101101249-101101271 ATTTAAATGGAGAATAACAAAGG - Intronic
1103189102 12:118985332-118985354 ATTTCCATGGAGCATTCTGTTGG + Intronic
1104098022 12:125578031-125578053 ATTTACATGGAGCATTCTCTAGG - Intronic
1105538712 13:21295139-21295161 CTTTACATAGAGAATAATCTGGG - Intergenic
1105989590 13:25605003-25605025 AATTACATGGTGCATCATAAAGG + Intronic
1107291067 13:38853695-38853717 TTTTACATAGAGAATAATCTGGG - Intronic
1107828400 13:44351484-44351506 ATTTACATGGAGCCTCAGCTGGG + Intergenic
1109710620 13:66154059-66154081 ATTTTCAGGAAACATAATATTGG + Intergenic
1110101094 13:71603823-71603845 ATTTACATGGAGCATAATATCGG - Intronic
1111434600 13:88190567-88190589 ATTTCTATGGAGTATAAAATGGG - Intergenic
1113747001 13:112752248-112752270 ATGTACATGGAGAAGAAAATGGG + Intronic
1114734436 14:25029646-25029668 TTTCACATGAAGCATTATATAGG - Intronic
1115276159 14:31611537-31611559 ATTTCCATGAAGAATGATATTGG - Intronic
1116912055 14:50478682-50478704 ATTTTCTTTGAGCATAATGTTGG + Intronic
1117813371 14:59571906-59571928 ATTTCCTTTGAGCATAATTTTGG + Intronic
1120713503 14:87816846-87816868 ATTTACAGGGTACATAATAGGGG + Intergenic
1123634244 15:22287636-22287658 ATTTCCATGGAGAATATTACAGG - Intergenic
1124890580 15:33728644-33728666 ATTTCCATTGAGCATCATGTTGG + Intronic
1126236053 15:46385805-46385827 CTTTTCATGGAGCATATTAAGGG + Intergenic
1127939255 15:63677137-63677159 ATTTCCATTGAGCATCATGTTGG - Intronic
1130246286 15:82252685-82252707 ATTTACCTGTTGCATAATGTAGG + Exonic
1132392429 15:101448891-101448913 ATGTACCTGAAACATAATATAGG - Intronic
1135064696 16:19299612-19299634 ATTTACCTGGAGGAGAAGATAGG - Intronic
1137036284 16:35572658-35572680 ATTTACAAGATGCATAATAATGG + Intergenic
1138438129 16:57017924-57017946 ATTTCCATGGGGAATAATCTTGG - Intronic
1138891353 16:61148053-61148075 TTTTACATGGTGAATAATAGGGG + Intergenic
1141013584 16:80426532-80426554 ATTTACAAGGAGCATGGTAGAGG + Intergenic
1141355764 16:83345268-83345290 ATTTACATGGTGCCCAACATCGG - Intronic
1147520094 17:41162780-41162802 ATTTTCTTTGAGCATCATATAGG - Intergenic
1149678874 17:58489983-58490005 ATTTAAATGGAGCTGAATAATGG - Exonic
1150440581 17:65188134-65188156 AGTTACATGGAGCAGAAAAGTGG + Intronic
1156193784 18:34750075-34750097 ATTCACCTGGAGCAAAATGTAGG + Intronic
1157669443 18:49515909-49515931 ATTGACATGCTGCATAACATTGG + Intergenic
1158274170 18:55748459-55748481 ACTAACATGGAGCATAGTAGCGG + Intergenic
1159118215 18:64139461-64139483 TTTTACATGCAGCATTTTATTGG + Intergenic
1159449324 18:68579595-68579617 CTGTACAGGAAGCATAATATGGG - Intergenic
1159675891 18:71283970-71283992 ATTTACATAGGGCATAAAAATGG + Intergenic
1165163839 19:33836389-33836411 ATTTTTATTGAACATAATATTGG + Intergenic
927542119 2:23921796-23921818 ATTTACATGGAGTACAATATAGG - Intronic
930386516 2:50702289-50702311 ATTTTCATGAACCATACTATGGG + Intronic
932454237 2:71836180-71836202 ATTTTCCTGGACCTTAATATAGG + Intergenic
932624704 2:73288097-73288119 ATCTACATGGACCAAAATAGGGG + Intergenic
936994898 2:118403115-118403137 ATTCAGTTGGAGCATAATTTGGG - Intergenic
937481459 2:122264544-122264566 ATTTACTAGAAGCATAATTTTGG + Intergenic
939423138 2:141999425-141999447 ATTTACATTGCTCCTAATATGGG - Intronic
941156818 2:161989169-161989191 ATTTCTATGGGCCATAATATTGG + Intergenic
942706866 2:178783922-178783944 ATTTTTATGGAGCATAGTATGGG - Intronic
944449570 2:199827285-199827307 ATTTACTTGTAGCAGAATCTGGG - Intronic
945479433 2:210327260-210327282 ATCTACATGCAGAAGAATATAGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
947279226 2:228429711-228429733 GTTTACATGTAGAATAATATTGG + Intergenic
947304810 2:228733029-228733051 ATTTACATTTAAAATAATATTGG + Intergenic
1171080250 20:22174529-22174551 ACTTATATGCAGCATAATACTGG - Intergenic
1174577553 20:51547356-51547378 CTTAAAATGGAGCATAATTTGGG + Intronic
1177923706 21:27186978-27187000 ATTTACCGGGAGCATGATCTGGG + Intergenic
1178569113 21:33718111-33718133 ATTTACCTGATCCATAATATGGG + Intronic
1182651681 22:31856744-31856766 ATTAACATGCAGCATAAAACAGG - Intronic
1183552218 22:38496313-38496335 ATTTACTTTGAGGATCATATTGG + Intronic
1183777631 22:39977365-39977387 ACTTACATCAACCATAATATTGG - Intergenic
949956722 3:9275161-9275183 GTTTACATTGTGCATAACATGGG + Intronic
951882898 3:27496808-27496830 ATTTAAGTGGAGTATAATGTGGG - Intergenic
952033080 3:29167925-29167947 AGTTACATGGAGCAAACTACTGG + Intergenic
953587712 3:44220055-44220077 ATTTAAATGGATCATACTGTAGG - Intergenic
958740388 3:98062809-98062831 CTTTGCATGGAGAAAAATATGGG - Intergenic
958772439 3:98441647-98441669 ATTTAAAAGGACCAAAATATAGG - Intergenic
960018622 3:112922368-112922390 ATTTTTGTGGAGCAAAATATTGG - Intronic
962645001 3:137429508-137429530 ATTTATATGGAGTTTAAAATAGG + Intergenic
963072596 3:141317030-141317052 ATTTTCTTTGAGCATCATATGGG - Intergenic
964252208 3:154731450-154731472 CTATAAATGGAGCCTAATATTGG + Intergenic
964796507 3:160503354-160503376 ATTTCCTTTGAGCATCATATTGG - Intronic
964873475 3:161338974-161338996 ATTTAGACAGAGCATTATATAGG - Intergenic
964933652 3:162055562-162055584 ATGTATATTGAGCATAATAATGG - Intergenic
965594818 3:170400376-170400398 ATGAACCTGGAGCATATTATGGG - Intergenic
965945375 3:174234025-174234047 ATTCACATGGAACTTAAAATAGG - Intronic
966695925 3:182791002-182791024 TCTTACAAGGAGCATAAGATAGG - Intergenic
968386054 4:139501-139523 ATTTACATAGGGCATACTAGGGG + Intronic
970525660 4:16929298-16929320 AGATGCATGGAGCAAAATATGGG - Intergenic
971594050 4:28505713-28505735 AATTATATGAAGCATCATATTGG + Intergenic
971843362 4:31885393-31885415 ATTTATCTGGAGTATAATTTGGG - Intergenic
972168879 4:36320858-36320880 TTATACATGTAGCATAAAATAGG + Intronic
972804840 4:42518695-42518717 TTTTACGTAGACCATAATATTGG - Intronic
972941569 4:44201595-44201617 AATTACATGGAGAATTACATTGG + Intronic
973321150 4:48811510-48811532 AATTACATAGAGCCTAAGATGGG - Intronic
973790266 4:54371806-54371828 AGTTACAAGGTGCATTATATAGG + Intergenic
974561011 4:63518185-63518207 ATTTACAAGGAGATTAATGTTGG + Intergenic
977149493 4:93492022-93492044 ATTTACATGGACAATAAATTGGG - Intronic
977494920 4:97763155-97763177 AATTACCTGGTGCATAATACAGG + Intronic
977502928 4:97863983-97864005 TTGTCCATGGAGTATAATATGGG - Intronic
978120336 4:105071482-105071504 ATTTACATGAAGACTAATTTAGG - Intergenic
978809335 4:112832828-112832850 ATTTAACTGAAGCAGAATATTGG - Intronic
980344635 4:131596650-131596672 ATTTACTTGATACATAATATTGG - Intergenic
981089522 4:140718444-140718466 TATTACATGGAGGATTATATAGG - Intronic
981702273 4:147619640-147619662 ATTTCCGTGGAGTATAGTATAGG + Intronic
983764871 4:171466330-171466352 ATTTATAGGTAGCATAATTTTGG - Intergenic
984303797 4:177960525-177960547 ATTTTCAAGGGGCATAGTATAGG + Intronic
988654682 5:33196172-33196194 TTTTCCATGGAGTATAATAAAGG + Intergenic
992180716 5:74195588-74195610 ATTTACCTTGACCATACTATAGG + Intergenic
993881706 5:93370580-93370602 GTCTACATGGAGCATTATCTGGG - Intergenic
994080544 5:95704601-95704623 ATTTATAAGGAACATATTATGGG - Intergenic
996326402 5:122279637-122279659 ATAAACATGAAGCATCATATGGG + Intergenic
997354925 5:133256245-133256267 ATTTAGAAGGAGAATAATGTGGG - Intronic
997959105 5:138305303-138305325 CTTTAAATGGAGAATAATAAGGG - Intronic
998196459 5:140077082-140077104 ATTGAGAGGGAGCAGAATATAGG + Intergenic
998594203 5:143510986-143511008 ATTTACAAGTTGCATAATCTTGG + Intergenic
1000461150 5:161520031-161520053 ATGAAAATGGAGCATAAAATGGG + Intronic
1006263862 6:32899236-32899258 ACTTACATGTGGCATCATATTGG + Intergenic
1007470924 6:42089691-42089713 TTTTACATGGAACACATTATTGG + Intergenic
1010120351 6:72368803-72368825 ATTTACAGGGAAAATAATATAGG + Intronic
1010930195 6:81792096-81792118 ATTTACATAGAGTATCATACTGG + Intergenic
1011530269 6:88313259-88313281 ATTTAGATGGAGTAAAATAGTGG - Intergenic
1011833080 6:91397131-91397153 ATTTACAATGAGAATAATAATGG - Intergenic
1012568661 6:100694693-100694715 ATTTACTTTGAAGATAATATTGG - Intronic
1012660955 6:101891216-101891238 AATTAGAAGTAGCATAATATTGG + Intronic
1012840496 6:104323532-104323554 TTTTATATGTAGAATAATATGGG + Intergenic
1013134609 6:107269293-107269315 ATTTAGATGGTGCAAAATCTAGG + Intronic
1013165210 6:107583923-107583945 ATTTACTTTGAGCATCATGTTGG + Intronic
1013764903 6:113563311-113563333 AGTTACAAGGAACAGAATATTGG - Intergenic
1015232393 6:130930393-130930415 ATTTTCTTTGAGCATAATGTTGG - Intronic
1015719673 6:136228220-136228242 ATTTACACGGAGGATAATTTAGG - Intergenic
1016104882 6:140149202-140149224 AATTGCAAGGAGCAGAATATAGG - Intergenic
1016511365 6:144846907-144846929 ATTTACATGGAGAATAAAGTAGG - Intronic
1017332849 6:153219727-153219749 ATATAAATGGAACAGAATATAGG + Intergenic
1017926057 6:158912576-158912598 ATTTACATGGAGCTTCTTATGGG + Intergenic
1020625668 7:10576172-10576194 ATTTTCATGGAGCAAGATAGAGG + Intergenic
1020720460 7:11738264-11738286 ATTTCCTTTGAGCATAATGTTGG + Intronic
1021049253 7:15962163-15962185 AATTACATGGGGCATAATAGGGG + Intergenic
1021430483 7:20553190-20553212 ATTTGCATGGAGCAGAATTGAGG + Intergenic
1022903882 7:34837243-34837265 ATATACATCTAGGATAATATTGG - Intronic
1024127385 7:46314004-46314026 ATTTTTATGGAGAATATTATTGG + Intergenic
1028806408 7:95031406-95031428 ATTTATCTTGGGCATAATATTGG + Intronic
1029105679 7:98173539-98173561 ATTTTAAAAGAGCATAATATTGG + Intronic
1030545180 7:110885266-110885288 ATTTCCTTTGAGCATCATATTGG + Intronic
1030655574 7:112163600-112163622 ATTTACATAGAGCATAGTATAGG + Intronic
1032252235 7:130268091-130268113 ATGTACAGGGACCAGAATATGGG - Intronic
1032274695 7:130444144-130444166 ATTTGCATGGAGAAAAATACAGG + Intergenic
1032735288 7:134687193-134687215 ATGTCCATGGATCAGAATATGGG + Intergenic
1032831116 7:135627401-135627423 ATTTCCTTTGAGCATCATATTGG - Intronic
1033108831 7:138557294-138557316 ATTTACAGGGAGCATCAAAGGGG - Intronic
1033674747 7:143529308-143529330 ATTTACATTGATTATAATAATGG - Intergenic
1033697089 7:143800131-143800153 ATTTACATTGATTATAATAATGG + Intergenic
1033757466 7:144406646-144406668 ATTTACATGAAGAATTTTATTGG + Intronic
1034567066 7:151923921-151923943 ATTTTCAAGGAGCATCATTTTGG - Intergenic
1035702924 8:1651038-1651060 GATTACATGGGGAATAATATGGG + Intronic
1036013613 8:4756199-4756221 TTTAACATCTAGCATAATATAGG + Intronic
1036030630 8:4967536-4967558 ATTTGCATGGGGGAAAATATTGG - Intronic
1038193818 8:25347978-25348000 CATTACAGGGAACATAATATTGG - Intronic
1039384962 8:37127470-37127492 ATTTACAGAGAGCCTACTATGGG - Intergenic
1041888708 8:62844259-62844281 ATTTACAGAGAGCATAATGGGGG + Intronic
1041947806 8:63466185-63466207 ATTCAAATGGAGCTTAATTTGGG - Intergenic
1042628940 8:70794633-70794655 ATTAATATGGTGCATTATATTGG + Intergenic
1043716993 8:83499183-83499205 ATTTACTTGTAGCATAAAACTGG + Intergenic
1043785367 8:84391621-84391643 ATTTAGATACAGCATAAAATTGG + Intronic
1044054365 8:87550047-87550069 AATTCCATGGAGAATAACATTGG + Intronic
1045593608 8:103627859-103627881 ATTTAGATGAAGCATACTTTGGG + Intronic
1046285180 8:112084443-112084465 ATTTCCATGGGACATAAAATAGG + Intergenic
1048645973 8:136420193-136420215 ATTTATATGGTGCCTAATATTGG + Intergenic
1048749543 8:137656184-137656206 ATTGTCATGGAGGATAAGATTGG + Intergenic
1048778740 8:137978104-137978126 ATTTACATGGAACATAATTATGG - Intergenic
1050819337 9:9857653-9857675 ATTTACATTTTGTATAATATGGG - Intronic
1050974871 9:11925075-11925097 ATTTATATTCAGCATAGTATTGG - Intergenic
1051110122 9:13626328-13626350 ATTTTTATGGAGAATATTATTGG + Intergenic
1053589241 9:39494568-39494590 GTATACATGGAGCATAATTCAGG + Intergenic
1054577057 9:66870725-66870747 GTATACATGGAGCATAATTCAGG - Intronic
1055045179 9:71916788-71916810 ATTTACTTTGAACATGATATAGG + Intronic
1056081565 9:83099867-83099889 AGTTACTTTAAGCATAATATGGG - Intergenic
1057045483 9:91883047-91883069 ATTTCCTTGGAGCATCATGTTGG - Intronic
1185572402 X:1145114-1145136 AGATACATGGAGCAGAGTATAGG + Intergenic
1187483610 X:19681133-19681155 ATTTACTTTGAGAATCATATTGG + Intronic
1187601997 X:20841858-20841880 ATTTATAGGGTGCACAATATCGG + Intergenic
1188028425 X:25235901-25235923 ATGTACATGGAGAAAAAGATTGG + Intergenic
1188994301 X:36863713-36863735 ATTAACCTGGATCATTATATGGG - Intergenic
1189065054 X:37798722-37798744 ATTTACATGTAACATTATAGAGG - Intronic
1193527795 X:82614826-82614848 ATATACATGTAGCTTAACATTGG - Intergenic
1193802045 X:85947533-85947555 ATTTACAGGGAGCATGGTACTGG - Intronic
1194557275 X:95375884-95375906 ACTTACATGTAGAATAAAATTGG + Intergenic
1194924894 X:99812734-99812756 ATTTATATGACGCATATTATTGG - Intergenic
1195234470 X:102883094-102883116 ATTCACATGGAATAAAATATTGG + Intergenic
1195398866 X:104440445-104440467 ATTAATATGAAGCATTATATTGG + Intergenic
1195945502 X:110206409-110206431 AATTACAAGGAATATAATATGGG - Intronic
1196507921 X:116470629-116470651 ATTTCCATGAAGAATGATATTGG + Intergenic
1197588625 X:128381726-128381748 ATTCACATGCAGAATAAAATTGG + Intergenic
1197691974 X:129511559-129511581 ATGTAGATGAAGCATAATAATGG + Intronic
1198299442 X:135320700-135320722 CTTAACATGGAGAAAAATATGGG + Intronic
1198766482 X:140084986-140085008 ATTTACATGGAATTTACTATTGG - Intergenic
1201621988 Y:15969640-15969662 AATTATGTGAAGCATAATATTGG + Intergenic
1201946090 Y:19512009-19512031 TTTTACATGGTGCATAGTAGAGG - Intergenic
1202305629 Y:23467302-23467324 ATTTCCATGGAGAATATTACAGG - Intergenic
1202565180 Y:26203287-26203309 ATTTCCATGGAGAATATTACAGG + Intergenic