ID: 1110108243

View in Genome Browser
Species Human (GRCh38)
Location 13:71707873-71707895
Sequence GAGCCATACTCAAGGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110108243 Original CRISPR GAGCCATACTCAAGGGCACA TGG Intronic
900693478 1:3995706-3995728 GAGCCAGCCTCAGGGGTACAGGG - Intergenic
900969849 1:5985537-5985559 GAGCCATGCACAAGGCCACCTGG + Intronic
904440581 1:30526992-30527014 CATCCAAACTGAAGGGCACAGGG + Intergenic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
906789775 1:48648623-48648645 GAGCCATGTTCAAGGCCATAGGG - Intronic
907977433 1:59445589-59445611 GTGCCATAGGCAAGGACACAGGG - Intronic
918479168 1:184959072-184959094 GAACCAGAATTAAGGGCACAAGG + Intronic
918947087 1:191080726-191080748 AAGCCATGTTCAAGGGCAGAAGG + Intergenic
919779304 1:201212209-201212231 GAGACAGCCTCAGGGGCACAGGG + Exonic
919801156 1:201355323-201355345 TAGCCTTTCTCAAGGGCTCAAGG - Intergenic
920380109 1:205530244-205530266 GATTCATACTGAAAGGCACAGGG - Exonic
921028883 1:211318901-211318923 GATCCATTTTCAAGTGCACATGG - Intergenic
922960453 1:229641628-229641650 GAGCCATCCTTAAGGACACAGGG - Intronic
1063033652 10:2262645-2262667 GAGACAAAGTCAAGGGCACAGGG - Intergenic
1063969454 10:11371368-11371390 GAGCCATAGTCAGGAGCCCATGG + Intergenic
1066029449 10:31404877-31404899 GAACCAAAGTCAAGGTCACAGGG + Intronic
1067791582 10:49292489-49292511 GAGCCATACCCAAAGGCTCCTGG + Intergenic
1068218110 10:54009865-54009887 GAGCCATACTCAGGCACACAGGG + Intronic
1069274422 10:66571486-66571508 GTGGCTTACTCAAAGGCACATGG + Intronic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1072159301 10:92751524-92751546 GAGACTTACTTAAGGTCACATGG + Intergenic
1075096137 10:119472766-119472788 AAGCCATATGAAAGGGCACAGGG + Intergenic
1080042218 11:27770820-27770842 GAGCCTTACTCATGGGCAGGTGG + Intergenic
1080931982 11:36820355-36820377 GAGCCATGCTCAACCCCACATGG - Intergenic
1084859619 11:72009725-72009747 GAGCCTTACTCTAAGGCACTTGG + Intronic
1086994819 11:93344227-93344249 GAGACATACACAAGGTCAAATGG - Intronic
1094408672 12:30146865-30146887 GAGCCAGGCTCAGTGGCACATGG + Intergenic
1094460214 12:30689065-30689087 GAGCAATCTTCAAGGGTACATGG + Intronic
1094692950 12:32787480-32787502 GTGCCATACGCAAGAGGACAAGG - Intergenic
1098926466 12:76356191-76356213 GAGGAATACTTAAGGGCTCAGGG + Intronic
1102897031 12:116606576-116606598 GAACCATCCTCAAGGACAAATGG + Intergenic
1105503184 13:20989515-20989537 GAGACAAGCTGAAGGGCACATGG + Intronic
1107392957 13:39986241-39986263 CAGACATACACATGGGCACAGGG + Intergenic
1110108243 13:71707873-71707895 GAGCCATACTCAAGGGCACATGG + Intronic
1112296129 13:98188685-98188707 GAGCCATAGTGAAGCCCACAGGG - Intronic
1112422660 13:99267060-99267082 TAGCCATCCTCATGGGCATAAGG + Intronic
1112881740 13:104115659-104115681 GAGCCTGACTCAGGGGCCCAAGG - Intergenic
1114705753 14:24725301-24725323 GAGTAATACCCAAGGGTACATGG - Intergenic
1115235647 14:31207144-31207166 GAACCCTTCTCAAGGGCAAAAGG + Exonic
1115930113 14:38482057-38482079 GAGCAGTAGTCAAGGTCACAAGG + Intergenic
1119748878 14:77063888-77063910 GAGACATTCTCAAGGTCACATGG + Intergenic
1120760306 14:88278963-88278985 GTGCCAAACTCACAGGCACATGG + Intronic
1120861959 14:89262643-89262665 GCCCCATATTCAGGGGCACAGGG - Intronic
1122062147 14:99143211-99143233 CAGCCAGACCCAAGGGCCCAAGG - Intergenic
1123994032 15:25705936-25705958 GAGCCATCCTCACGTGCACCTGG + Intronic
1124357953 15:29011574-29011596 GAACTACACACAAGGGCACATGG - Intronic
1125904715 15:43380310-43380332 GAGCCATAATAAAGGTTACATGG - Intronic
1127716367 15:61653049-61653071 GAGCCATACTCAGGGACCCAGGG + Intergenic
1129516606 15:76161188-76161210 GAGCCATGCTGAAAGGCCCACGG - Intronic
1130222981 15:82036878-82036900 AAACCATACTCAAGGGGAGAGGG + Intergenic
1133505425 16:6407624-6407646 GAGCCATAATCAAGGCAGCATGG + Intronic
1137310014 16:47245877-47245899 GGACCATACTCACGGTCACAAGG + Intronic
1138648727 16:58444720-58444742 GAGCCAGATCCAAGAGCACAGGG - Intergenic
1139120573 16:64011670-64011692 TAACCATACTCAAAGGCTCAAGG - Intergenic
1141586733 16:85038888-85038910 GAGCCACATTCATGGGCTCAAGG + Intronic
1141601218 16:85127427-85127449 GAGCCTTATGCCAGGGCACATGG - Intergenic
1142307704 16:89294813-89294835 GAGCGTTTCTCAGGGGCACACGG - Intronic
1143706046 17:8698317-8698339 CAGCCAGACACAAGGGCTCAAGG + Intergenic
1145803448 17:27707435-27707457 GTGAAATACTCAAGAGCACAAGG - Intergenic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1146692402 17:34885552-34885574 GAGACATACTCCAGGGCCCAGGG - Intergenic
1146927220 17:36753379-36753401 CAGCCTTGCTCAAGGTCACAGGG + Intergenic
1148130805 17:45261815-45261837 GAGCCGTAGTCAGGGGCACCGGG + Intronic
1151079851 17:71316383-71316405 GAAACATACTCAGGGGAACAGGG + Intergenic
1152372449 17:79897829-79897851 GAGCAATGCTTAAGGACACAAGG - Intergenic
1152423114 17:80204678-80204700 CAGCCATCCTCCAGGGCACAGGG - Intronic
1156596378 18:38552410-38552432 GAGGCTTATTCAAGGTCACATGG - Intergenic
1157104041 18:44756523-44756545 AAGCCAGGCTCCAGGGCACACGG + Intronic
1157113323 18:44841458-44841480 CAGCCACACTCAAGGGGAAAGGG + Intronic
1157660393 18:49436528-49436550 GAGGCATATTCAGGGTCACAGGG - Intronic
1160730325 19:639105-639127 GAGCCATACCCCAGGCCCCACGG - Intergenic
1161067286 19:2244893-2244915 GAACCGTACTCAAGCGCCCAGGG - Intronic
1161243283 19:3234860-3234882 GAGCCAGGGACAAGGGCACAGGG - Intronic
1165180468 19:33963179-33963201 GAGTCAGACTCAAGCCCACAGGG + Intergenic
1167470576 19:49673530-49673552 GACCCAGACAGAAGGGCACAGGG - Intronic
926534159 2:14089815-14089837 GATCCTTTCTCAAGAGCACATGG + Intergenic
933223110 2:79714060-79714082 GTGCCATACACAAAGGCACCAGG - Intronic
933809091 2:86021367-86021389 CACCCATATTCAAGGGCAAAGGG + Exonic
938480233 2:131657169-131657191 GTGCCATAGTCCAGGGCGCAAGG + Intergenic
938480243 2:131657206-131657228 GTGCCATAGTCCAGGGCGCAAGG + Intergenic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
946456611 2:219831800-219831822 GAGCCAAACTCAAGAGGAAAGGG - Intergenic
947816782 2:233042710-233042732 GAGCCATAGTCAGGGACACCGGG + Intergenic
1171016281 20:21544788-21544810 AAGCCATACCCAACAGCACAAGG + Intergenic
1172567199 20:35939901-35939923 TAGACATAGTCAAGGGCACAAGG - Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1181432289 22:22888763-22888785 GGGCCAGGCTCAAGGACACAGGG + Intronic
1181494700 22:23281375-23281397 GAGTCGTCCTCCAGGGCACACGG - Intronic
1183766157 22:39877248-39877270 GAGCCACAATAAAGAGCACATGG + Intronic
953533285 3:43757057-43757079 CAGCCATGCTGAAGGGCTCAGGG - Intergenic
953932116 3:47010621-47010643 TAGCCATACACATGGGCACATGG + Intergenic
954636014 3:52071277-52071299 GAGCCATGCCCCAGGGCACCAGG + Intergenic
954708937 3:52495500-52495522 GAGCCAGTCGCAGGGGCACACGG + Intronic
956000739 3:64727517-64727539 CAGCCATACAGAAGGACACAGGG - Intergenic
956321270 3:67999401-67999423 GAGGCTTACTCAAGGGAACGTGG - Intergenic
959860844 3:111212992-111213014 GAGCCACAGACAAGGGCTCAGGG + Intronic
960237977 3:115306620-115306642 GATTCATGCTAAAGGGCACAAGG + Intergenic
960915488 3:122690250-122690272 GAGACATGCCCAAGGTCACATGG + Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
965337588 3:167446449-167446471 GAGCCAGACTCATGATCACAGGG + Exonic
965684884 3:171292227-171292249 GACCCATTCTCAAGGGAAAATGG - Intronic
965799315 3:172475514-172475536 GAGGCCTACTCAAGGGTAGAGGG - Intergenic
967872812 3:194246254-194246276 GGGCCAAACTCTAGGGCAAAGGG - Intergenic
976482161 4:85557364-85557386 GAGCCCTGCTCAAGCACACATGG - Intronic
977638529 4:99328713-99328735 CAGCCATACTAAATGGCACTGGG - Intergenic
978269051 4:106865750-106865772 GAGCAACAAACAAGGGCACAGGG - Intergenic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
985285118 4:188329433-188329455 GAGCCAAATTCAAGTGCCCATGG + Intergenic
985539306 5:480487-480509 GAGCCGCCCTCCAGGGCACAGGG + Intronic
987199993 5:15567554-15567576 GAGACAGACTTAAGGGCAAAAGG - Intronic
991547660 5:67801269-67801291 GAGCAATCATCAGGGGCACAGGG + Intergenic
992612106 5:78516804-78516826 AAGACAGGCTCAAGGGCACAAGG - Intronic
1002077552 5:176717943-176717965 GAGCAGGACCCAAGGGCACAGGG - Intergenic
1006175854 6:32121062-32121084 GAGGCATCCTGAAGGGGACAGGG + Exonic
1007389659 6:41543771-41543793 GGGCCATAGTTAAGAGCACAGGG - Intergenic
1007953623 6:45896430-45896452 GAGCCTTGCTCAAGGGCACATGG + Intergenic
1008487368 6:52050705-52050727 GAGGCATACACAGGGGCACTTGG + Intronic
1015629299 6:135215446-135215468 GCGCCATACTCAAGGTTACCTGG - Intronic
1024576156 7:50766230-50766252 GAGCCCTCCACAAGGGCAGAGGG - Intronic
1026066234 7:67075739-67075761 GAGCAATACCCAAGGGGATAGGG + Intronic
1027603151 7:80264947-80264969 TGGCCATAATCAAAGGCACATGG - Intergenic
1037063472 8:14545638-14545660 TAGCCATCCACAAGGGCAAATGG + Intronic
1037907212 8:22722658-22722680 GAGACACAATCAAGGGCACCAGG - Intronic
1039256892 8:35728989-35729011 TAGTCATACACAAAGGCACATGG - Intronic
1041414298 8:57590382-57590404 GAGCCATACTACAGAGCACACGG + Intergenic
1041494179 8:58467955-58467977 GAACCACATACAAGGGCACAGGG - Intergenic
1042325277 8:67521825-67521847 GAGTCAGACTCCAGGGCCCATGG - Intronic
1043119696 8:76307636-76307658 GAGCCAGACAGAAGGGCAAAAGG + Intergenic
1044113918 8:88310867-88310889 GACCAAAACTCAAAGGCACAAGG + Intronic
1049491637 8:142906729-142906751 CAGCCAAACTCAATGGCACGTGG - Intronic
1056786011 9:89593042-89593064 GAGCCCCACTCCAGGGCAGAAGG - Intergenic
1059243950 9:112833805-112833827 GAAACATCCTCAAAGGCACAAGG - Intronic
1059382013 9:113934158-113934180 GGGCCCAACTCACGGGCACACGG + Intronic
1061513148 9:131072908-131072930 GAGTCATACCCAAGGTCACCAGG - Intronic
1062539942 9:137037152-137037174 GAGCGTCACTCAAGGGCGCAGGG - Exonic
1186019306 X:5236034-5236056 GAGCCATAATCAGAGGCAAAAGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1191715323 X:64190246-64190268 GTGCCAGAGTCAAGGGCACCTGG - Exonic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1199760234 X:150899064-150899086 GAGCCCTTCTCAAGGTCACCCGG - Intergenic