ID: 1110109877

View in Genome Browser
Species Human (GRCh38)
Location 13:71732671-71732693
Sequence CTGTATTTACAAATAAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110109877_1110109881 18 Left 1110109877 13:71732671-71732693 CCTACCTTTATTTGTAAATACAG 0: 1
1: 0
2: 3
3: 58
4: 425
Right 1110109881 13:71732712-71732734 ACAACCTTTTGTTTATTTTGTGG 0: 1
1: 0
2: 3
3: 46
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110109877 Original CRISPR CTGTATTTACAAATAAAGGT AGG (reversed) Intronic
900668828 1:3836401-3836423 GTGTACTTACACATAAAGGAGGG - Intronic
901265873 1:7910287-7910309 CGGTTTTTACAAAGAAAGGCAGG - Intergenic
901889546 1:12250813-12250835 CTTTATTTACAAAAACAGATGGG - Intronic
902605414 1:17566398-17566420 CTGTAACTATAAATCAAGGTGGG + Intronic
904483862 1:30811223-30811245 CTGTCTATGCAAATAAAGCTTGG - Intergenic
904776304 1:32909289-32909311 CTGTATTTCCATATAAATTTAGG - Intergenic
904926584 1:34053955-34053977 GTCTATTTACAAATTCAGGTGGG - Intronic
905610502 1:39346436-39346458 CTGTATTTGGAAATCAAGGTAGG + Intronic
905953218 1:41970754-41970776 ATGTCTTTACAAAAAAAAGTGGG + Intronic
906339449 1:44966141-44966163 CTGTCTTTAAAAATGAAGGCCGG + Intronic
908143106 1:61208476-61208498 TTGAATTTAGAAATAAAGGATGG - Intronic
909132253 1:71752358-71752380 CTTTATATACAAAAATAGGTAGG + Intronic
909716698 1:78716944-78716966 CTGTATTTAAAAGTAATGTTTGG + Intergenic
909787948 1:79640034-79640056 CTGATTTGACTAATAAAGGTTGG + Intergenic
909792658 1:79697641-79697663 CTGATTTGACTAATAAAGGTTGG + Intergenic
910194572 1:84626720-84626742 TTGTATTTCCAAATGCAGGTTGG + Intergenic
911356914 1:96834004-96834026 ATGTATTTACAAAAAAAGGAAGG - Intergenic
911497106 1:98645002-98645024 CTTTATTTATAAATATAGGTTGG + Intergenic
911561353 1:99409919-99409941 CTGTATTTACACATGAACATGGG - Intergenic
913616540 1:120565618-120565640 CTGTATTTGCACAAACAGGTGGG - Intergenic
914573737 1:148945293-148945315 CTGTATTTGCACAAACAGGTGGG + Intronic
914903387 1:151724641-151724663 CTGTATTTACCAATATAGGCTGG - Intronic
915012109 1:152697432-152697454 TTTTATTTAAAAATATAGGTAGG - Intergenic
915441768 1:155950072-155950094 CTGTTTTTACTTCTAAAGGTTGG + Intronic
917465598 1:175273168-175273190 ATGTATTTCCAAATAAATGTGGG - Intergenic
918311155 1:183286391-183286413 CTGCATTTAAATATAAACGTAGG - Intronic
918499708 1:185180177-185180199 CTGTCTTTAAAAAAAAAGTTTGG + Intronic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
919588207 1:199465410-199465432 CAGTTCTTACAAAGAAAGGTAGG + Intergenic
921481227 1:215666745-215666767 CAGTATTTCCAAAAAAAAGTGGG + Intronic
921572914 1:216799955-216799977 TTTTATTTGCAAATAAATGTGGG - Intronic
921839388 1:219812214-219812236 CTGTATAAACGAATAAAGGAAGG + Intronic
922370782 1:224908721-224908743 CTGAATTTAAAATTAAATGTGGG + Intronic
922436175 1:225608943-225608965 CTGTATTTACAAGTCAAGGTTGG - Intronic
922628583 1:227080237-227080259 CTGTATTTCCAAGTAAAAATAGG - Intronic
923091806 1:230746790-230746812 CTTTATTTACAAAGGCAGGTGGG - Intergenic
923164422 1:231346142-231346164 CTCTTTTTATAAATAAAGTTGGG + Intronic
923299335 1:232627205-232627227 CTGCATTTACCAATTATGGTTGG + Intergenic
923390941 1:233514357-233514379 TTGTATTTTTAAATAAAGATGGG + Intergenic
924334094 1:242969467-242969489 CTGTGTTTTCAAAAAAAGGGTGG + Intergenic
924713721 1:246552905-246552927 CTCTATTTAAAAACAAAGGGAGG + Intronic
1063127522 10:3148875-3148897 CTATATTTAAAAAGAAAGGCAGG + Intronic
1063230151 10:4058307-4058329 GTATATTTAAAAATAAAAGTTGG - Intergenic
1065172191 10:23042620-23042642 CTGTATCTACTAAAACAGGTGGG + Intergenic
1065489970 10:26272891-26272913 CTGAACTTACAACAAAAGGTGGG + Intronic
1066058526 10:31702833-31702855 TTGTTTATACAAATAAATGTGGG - Intergenic
1067485317 10:46643643-46643665 CTCTATTTACAAATATATCTCGG + Intergenic
1067609441 10:47698020-47698042 CTCTATTTACAAATATATCTCGG - Intergenic
1068397956 10:56488174-56488196 CTGTTTATATAAATAAAAGTTGG + Intergenic
1068724988 10:60290817-60290839 CTCTATTTAAAGATAAAGTTGGG - Intronic
1068735177 10:60406261-60406283 CTTTATTTACAAAAACAGGCAGG + Intronic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1071079247 10:81790490-81790512 ATGTATTTAGAAATACAAGTTGG + Intergenic
1071212194 10:83356193-83356215 CTGTATTTGCAAAAATAGTTTGG + Intergenic
1072269373 10:93760819-93760841 CTGCTTTTAGAAATAAAGGCTGG - Intronic
1073891750 10:108110672-108110694 CCGTACTTACAACTAAATGTCGG + Intergenic
1074329950 10:112496266-112496288 AAGTATTTACATATGAAGGTTGG + Intronic
1074533822 10:114314503-114314525 ATGTATTAACAAAGAAAGGAAGG + Intronic
1075126554 10:119704917-119704939 CTGTCTTTACAAAAATAGATAGG + Intergenic
1075996554 10:126881542-126881564 CTGAAATTAAAAATAAAGATGGG + Intergenic
1076706444 10:132304594-132304616 CTGTATTTCCAGAAAAAGGCTGG + Intronic
1077294592 11:1819922-1819944 CTTTATTTACAAAAACAGATGGG + Intergenic
1077864143 11:6209382-6209404 TTGAATTTACAAATCAAGGGGGG - Intronic
1078678615 11:13452119-13452141 CAGTATCTAATAATAAAGGTAGG + Intronic
1079125746 11:17717808-17717830 CTGAATGAACAAATACAGGTGGG + Intergenic
1079378574 11:19916796-19916818 TTTTATTTACAAAAATAGGTGGG + Intronic
1080329803 11:31123066-31123088 CTGTATTTACAAAAAAAAACAGG + Intronic
1080995763 11:37598807-37598829 CTGTAGTTAAAACTAAAGGGAGG + Intergenic
1081092182 11:38885371-38885393 ATGTCTTAACAAATACAGGTGGG - Intergenic
1081189469 11:40085133-40085155 CTGTATCTGCAAATAAAATTGGG + Intergenic
1081744504 11:45463419-45463441 TTGAATTTACAAATAAAGACAGG - Intergenic
1081826827 11:46062444-46062466 CTTGATTTAAAAAAAAAGGTTGG - Intronic
1083002014 11:59301168-59301190 CTTTATTTACAAAAATAGTTTGG + Intergenic
1085437564 11:76522098-76522120 CAGAATTTACAACTGAAGGTTGG + Intronic
1086037064 11:82428929-82428951 TTGAATTTATAAATAAAGTTGGG - Intergenic
1086038794 11:82449589-82449611 CTGTTTTTTCAAATGAGGGTTGG - Intergenic
1087423315 11:97960145-97960167 CTATATTTACAAAAAAATCTTGG + Intergenic
1087705368 11:101484455-101484477 CCATATAGACAAATAAAGGTAGG - Intronic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088668422 11:112117825-112117847 ATGTATATATATATAAAGGTCGG - Intronic
1089646029 11:119879698-119879720 GTGTCTTTAAAAATAAATGTAGG + Intergenic
1090851446 11:130574097-130574119 CTGTATTTTCTAATAAAACTTGG + Intergenic
1091516150 12:1184276-1184298 CTGTCTTTAAAAAAAAAGCTAGG - Intronic
1093276268 12:17132054-17132076 CTCTATTTACAAATAGAAATGGG - Intergenic
1093612525 12:21179830-21179852 CTGTATCTACATATAAAGATGGG - Intronic
1094004921 12:25738992-25739014 CTGTATTTAAAAATAATTGATGG - Intergenic
1095051325 12:37557188-37557210 ATGTATATACAAATATAGGTTGG + Intergenic
1095054645 12:37584793-37584815 ATGTATATACAAATATAGGTTGG + Intergenic
1096253449 12:50048558-50048580 CTGTATTGCCCAATACAGGTCGG - Intergenic
1096889349 12:54751386-54751408 CAGTGCTTACAAATAAAAGTAGG + Intergenic
1097275690 12:57811993-57812015 CTGTCTTTAAAAAAAAAGGTGGG - Intronic
1097575166 12:61383621-61383643 CTTTAATTACAAATAATGGGGGG - Intergenic
1097852052 12:64421724-64421746 CTGTATTCACAAATAAAGACAGG - Intronic
1098142110 12:67460486-67460508 TTGGATTTAGAAATAAAGGACGG + Intergenic
1099209128 12:79763202-79763224 CTGCAGTTAGAAATAAAAGTTGG - Intergenic
1100490962 12:95077462-95077484 CTGTGTGAACAAAGAAAGGTTGG + Exonic
1100893525 12:99153645-99153667 CAATATTTAGAAAGAAAGGTTGG - Intronic
1101202705 12:102453572-102453594 CTGTATGTACAAAAAAAGAGAGG + Intronic
1101771669 12:107757736-107757758 CTGTAGTTAAAAAAAAAGTTTGG - Intronic
1103100349 12:118169321-118169343 CTGTCTTTAAAAAAAAAGGGGGG - Intronic
1104003569 12:124875906-124875928 CTTTATTTACAAAAACAGGCTGG - Intronic
1104003575 12:124875946-124875968 CTTTATTTACAAAAACAGGCTGG - Intronic
1104913106 12:132249796-132249818 CTGTGATTACAGAAAAAGGTGGG + Intronic
1106284268 13:28305583-28305605 CTGTATTTACAGAAACAGGTGGG - Intronic
1107226408 13:38054084-38054106 CTGTGTTTCCACATAGAGGTGGG + Intergenic
1107368062 13:39707425-39707447 CTGCAGTTAAAAATAAAGCTTGG - Intronic
1107429347 13:40326128-40326150 TTGTATTTATAATTAAAAGTTGG + Intergenic
1107665113 13:42680496-42680518 CAGGACTTACAAATCAAGGTGGG - Intergenic
1108550242 13:51536555-51536577 CTTCATTTAGAACTAAAGGTTGG + Intergenic
1108780962 13:53832609-53832631 ATACATTTATAAATAAAGGTAGG - Intergenic
1109076943 13:57847546-57847568 CTGTATTTTCAAATAATGCCAGG - Intergenic
1109207289 13:59496699-59496721 CGTTATCTACAAATATAGGTTGG + Intergenic
1109343947 13:61093146-61093168 CTGATTTGACTAATAAAGGTTGG - Intergenic
1109506613 13:63310796-63310818 CTGAATTTTCAAATTTAGGTGGG + Intergenic
1109684748 13:65803399-65803421 CTGTATTTATTCATAAAGATGGG - Intergenic
1109838080 13:67885518-67885540 ATGTAATTACACATTAAGGTAGG + Intergenic
1109959431 13:69611635-69611657 ATATTTTTACAAATAAAGATGGG - Intergenic
1109967997 13:69726612-69726634 ATGTTTTAATAAATAAAGGTAGG - Intronic
1110109877 13:71732671-71732693 CTGTATTTACAAATAAAGGTAGG - Intronic
1110230851 13:73165788-73165810 CTGTATCTAAAAATAAGGCTAGG - Intergenic
1110343370 13:74417864-74417886 CTTTATTTACAAAAAAATGTGGG - Intergenic
1111392300 13:87612347-87612369 CTGTATTAACAATTAAAACTGGG + Intergenic
1111673311 13:91356380-91356402 GTGGATTTAGAAATAAATGTGGG - Intergenic
1112541984 13:100323188-100323210 CTTTTTTTACAAAAATAGGTAGG + Intronic
1113707202 13:112442619-112442641 CTTTATTTACAAACCTAGGTGGG + Intergenic
1115031655 14:28803167-28803189 CTGGATTTACATCTTAAGGTAGG - Intronic
1115887407 14:37988326-37988348 CTGACTTTACATATAAATGTAGG + Intronic
1116756391 14:48953858-48953880 TTTTATTTAGAAATAAAAGTTGG + Intergenic
1116974208 14:51097373-51097395 CTGTAATTACAAGAAGAGGTAGG + Intergenic
1118424726 14:65648076-65648098 CTTTATTTACAAAAACAGTTGGG - Intronic
1118427288 14:65679867-65679889 CCATATTTACAAAAATAGGTAGG - Intronic
1119012092 14:71004078-71004100 ATTTATTTACAAAAACAGGTAGG - Intronic
1119210470 14:72827778-72827800 CTGTATTTAAGAGTAAAGGGGGG - Intronic
1120455922 14:84730409-84730431 GTGTATTTACAAGTAAGAGTTGG - Intergenic
1120501388 14:85301331-85301353 CTGTAATTTCAAATTAATGTTGG + Intergenic
1120520115 14:85517487-85517509 CTTTATTTACAAAACAAGGTGGG - Intergenic
1121056044 14:90853925-90853947 CTGTATATACCAGTACAGGTGGG + Exonic
1121110070 14:91306733-91306755 CTTTATTTACAAAAGCAGGTGGG + Intronic
1121295474 14:92817517-92817539 CTATATTTAAAAGTAAAGTTGGG + Intronic
1122021966 14:98845488-98845510 CTGGATTTACATATGAATGTTGG - Intergenic
1122032044 14:98919437-98919459 CTGTCTTTAGGAAAAAAGGTGGG - Intergenic
1122118592 14:99540138-99540160 CTGTCTTTAAAAAAAAAGGGGGG + Intronic
1122617984 14:103034209-103034231 ATGTTTTTAAAAATAAAGTTTGG - Intronic
1124394330 15:29288093-29288115 CTGTAGTTCTAAATATAGGTGGG + Intronic
1124849243 15:33319986-33320008 CTTTATTTGCAAATAGAGGCGGG + Intronic
1124896368 15:33780926-33780948 CTTTATTTACAAAAATAGGCAGG - Intronic
1125842506 15:42817326-42817348 CTGTATTTTAAAATGTAGGTAGG - Intronic
1126576490 15:50202175-50202197 CTTTATTTACAAAAACAGGTGGG - Intronic
1126611737 15:50536870-50536892 TTGTATTTACAGATCAAGTTGGG - Intronic
1127374913 15:58375391-58375413 CGGTTTTTACACAGAAAGGTGGG + Intronic
1128041883 15:64582138-64582160 CTTTATTTACAAAAACAGCTTGG - Intronic
1128434769 15:67635973-67635995 TTGTTTTTATAAATAAAGATGGG + Intronic
1131708560 15:95026056-95026078 TTTTATTTACAAAAACAGGTGGG - Intergenic
1133898991 16:9955505-9955527 CTGTTTTTGCCATTAAAGGTAGG - Intronic
1134384891 16:13762576-13762598 GAGAATTTACAAAGAAAGGTGGG + Intergenic
1135633331 16:24053436-24053458 CTTTATTTACAAAAACAGGCAGG + Intronic
1137718900 16:50615856-50615878 CTGTGTTTACAAACAGAGGTGGG + Intronic
1138824189 16:60298888-60298910 CTGGATTTATCAATAAAGTTTGG - Intergenic
1138968503 16:62115556-62115578 ATGTATTTTCATATAAATGTAGG + Intergenic
1139578063 16:67854936-67854958 CTGTCTTTAAAAAAAAAAGTTGG + Intronic
1139772204 16:69287265-69287287 CTTTATTTAAAAATACAGGCTGG + Intronic
1140160832 16:72491731-72491753 CTGTATTTAAAACCACAGGTCGG - Intergenic
1140780333 16:78290299-78290321 CTTTAATTACAAATAAACATGGG - Intronic
1142424936 16:89997092-89997114 TTGTATTTAAAAATCAAGATAGG - Intergenic
1145371959 17:22314073-22314095 ATGTATATACAAATATAGGTTGG + Intergenic
1145375328 17:22342271-22342293 ATGTATATACAAATATAGGTTGG + Intergenic
1145898792 17:28476395-28476417 TTGTTTTTTCAAATTAAGGTGGG - Intronic
1147495624 17:40912404-40912426 GTGTAGTTATAAATAAACGTTGG + Intergenic
1147850386 17:43437965-43437987 CTTTATTTACAAAAACAGGATGG + Intergenic
1148474531 17:47918830-47918852 CTTTATTTACAAAAACAGGCAGG - Intronic
1148776389 17:50097790-50097812 CTGTGTTTCCAGAGAAAGGTGGG - Intronic
1149538730 17:57452592-57452614 CTGGACTTACAAACAAAAGTGGG + Intronic
1153110094 18:1576188-1576210 CTTTATTTACAAATATAGATAGG - Intergenic
1153800028 18:8660481-8660503 CTGTAGTAACAAATTCAGGTCGG + Intergenic
1154220398 18:12448068-12448090 CTGTATTTGCATGTAAAAGTGGG - Exonic
1155484251 18:26324722-26324744 CTGTATTAACAAATGAGTGTAGG - Intronic
1155637279 18:27970908-27970930 CTTTATTTATAAAAATAGGTGGG + Intronic
1156119824 18:33829251-33829273 CTATATTAACAAATAAAGTCGGG - Intergenic
1156251575 18:35357418-35357440 CTGATTTGACTAATAAAGGTTGG + Intergenic
1156452222 18:37273363-37273385 CTGTATTTAAAAGTAATGCTAGG + Intronic
1158280257 18:55817562-55817584 CTGTATTTTCCACTAAGGGTAGG - Intergenic
1158897163 18:61925266-61925288 CTTTATTTACAAAACAAGGCAGG + Intergenic
1159514674 18:69442965-69442987 ATTTATTTACAAATAATGGAGGG + Intronic
1159596430 18:70386846-70386868 CTGTCTTTACCAATAAAGCATGG - Intergenic
1161634753 19:5380714-5380736 CTTTATTTACAAAAACAAGTAGG - Intergenic
1162394373 19:10408163-10408185 CTGTCTTTAAAAAGAAAGGAGGG - Intronic
1162617259 19:11812212-11812234 CAGTTATTAGAAATAAAGGTAGG - Intergenic
1163303040 19:16459761-16459783 CCGTATTTACAAAGAATGGTGGG + Intronic
1164517240 19:28946903-28946925 GTGCATTTACAAATAAAGTGTGG + Intergenic
1165047901 19:33120691-33120713 CTCTATTTAAAAAAAAAGGGTGG + Intronic
1165572852 19:36790248-36790270 ATGTATATACAAATATAGGTTGG - Intergenic
1165835687 19:38754058-38754080 CTGATTTGACAAATAAAGGCTGG - Intronic
1166394840 19:42431898-42431920 TTGTATTGACAAATAAATGGGGG - Intronic
924981428 2:225594-225616 CAGAATTTAGAAATAAAGTTTGG + Intronic
926047499 2:9720540-9720562 CTTTATTTACAAAAGCAGGTGGG + Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
926368756 2:12159128-12159150 TTGTATTTTCATATAAATGTAGG + Intergenic
926664300 2:15503335-15503357 CTGTATTTCCAATTCATGGTTGG - Intronic
928039699 2:27862335-27862357 AGGTATTCACAAAGAAAGGTGGG + Intronic
930601124 2:53444318-53444340 CTGTTCTTACAGAGAAAGGTGGG - Intergenic
930884487 2:56309554-56309576 GTGATTTTACAAATAAAGTTTGG + Intronic
931279227 2:60774011-60774033 TTGCAGTTAAAAATAAAGGTGGG - Intronic
931403759 2:61956014-61956036 CTGTTTTTACATATAAAGCACGG + Intronic
931585108 2:63817493-63817515 CTGAAATTACACATTAAGGTAGG + Intronic
932589541 2:73056193-73056215 ATGTATTTACAAATGTATGTAGG - Intronic
932935491 2:76097104-76097126 CTATATTAACAAAGAAAGGGAGG + Intergenic
933157311 2:78990629-78990651 AGGTATGTACAAATAAAGCTAGG - Intergenic
933338126 2:80985874-80985896 CTGTCTTTGAAAATAAAGGAAGG - Intergenic
934685542 2:96318618-96318640 CTGTATTTAAAAATCTGGGTTGG + Intergenic
935189079 2:100761452-100761474 CTGTATTTAAAAAAAAAAATAGG + Intergenic
935535792 2:104293069-104293091 CTGTATATAGAATTCAAGGTTGG + Intergenic
935555926 2:104509368-104509390 CTGTATTGACAAATTACGGTCGG + Intergenic
935683125 2:105655608-105655630 TTGTATTTTCAAAAAAAGATTGG + Intergenic
938256802 2:129865571-129865593 CTGCTTTTAAAAAAAAAGGTGGG + Intergenic
938801507 2:134767540-134767562 CTGTATTAAAAAATATAGGCTGG + Intergenic
938809375 2:134838453-134838475 CTTGATTAACAAATAAAGCTTGG + Intergenic
939185628 2:138857215-138857237 GTGTATTAACTAATAAAGTTTGG - Intergenic
940168969 2:150806170-150806192 CTAAATTTACACAGAAAGGTGGG + Intergenic
940278119 2:151960959-151960981 CTGTATTTAAAAATCAACTTTGG - Intronic
940389169 2:153111432-153111454 CTGTATTTACAAGTAGAAATAGG + Intergenic
940457860 2:153924053-153924075 CTGAATTTAAAAATAAAAGTTGG - Intronic
940530515 2:154871722-154871744 CTGATTTGACTAATAAAGGTTGG - Intergenic
940914099 2:159235693-159235715 CTCTCTTTATAACTAAAGGTTGG - Intergenic
940980314 2:159994307-159994329 TTGCATTAACAAATAAAGGCAGG + Intronic
941129723 2:161632055-161632077 GTGGAGTTACAAATAAATGTTGG - Intronic
942458486 2:176153240-176153262 TTGAATTTGCAAATGAAGGTTGG + Intronic
942509945 2:176687300-176687322 CTGTTATTAATAATAAAGGTCGG + Intergenic
942542427 2:177028462-177028484 CTGGCTTTGAAAATAAAGGTGGG + Intergenic
942909563 2:181226784-181226806 CTGTATATTCAAATAAACTTAGG + Intergenic
943284953 2:185985904-185985926 CTGTCTTTACAGAAAAAGTTTGG - Intergenic
943384640 2:187186110-187186132 CTGAATTTGAAAATATAGGTAGG + Intergenic
943555658 2:189401060-189401082 TTGTACTTAAAAATAAAAGTTGG - Intergenic
943584367 2:189720544-189720566 CTTTATTTAGAAATACAAGTTGG - Intronic
943593702 2:189830197-189830219 CTTTATTTACAAAAACAGGAAGG + Intronic
943935784 2:193914798-193914820 CTTTATTTTCATATAAAGTTGGG - Intergenic
945026024 2:205620757-205620779 CTGTATTTACCAATCAATGGTGG - Intergenic
947025379 2:225732215-225732237 CTGTATTCAAAGATAGAGGTAGG + Intergenic
947059615 2:226148677-226148699 CTGTCTACACAAAAAAAGGTGGG - Intergenic
947143757 2:227044417-227044439 CTGTATTTACAAACCATGCTGGG + Intronic
1169148625 20:3271421-3271443 CTGTATTTTCACCAAAAGGTTGG - Intronic
1169763460 20:9122299-9122321 CTGTATTTTAAAATAAAATTGGG + Intronic
1169921461 20:10738861-10738883 CTTCATTTACAAAAACAGGTGGG + Intergenic
1170325136 20:15148916-15148938 CTGTTTTGACTAATAAAGGCTGG + Intronic
1170548227 20:17453511-17453533 CTGAATTTACAATTTAAGCTGGG - Intronic
1171499395 20:25581604-25581626 CTGTATTGGCAAATAAAAGTGGG + Intronic
1171499508 20:25582591-25582613 CTGTATTGGCAAATAAAAGTGGG - Intronic
1171527607 20:25827513-25827535 ATGTATATACAAATATAGGTTGG - Intronic
1171545855 20:26000701-26000723 ATGTATATACAAATATAGATTGG + Intergenic
1171549219 20:26028371-26028393 ATGTATATACAAATATAGGTTGG + Intergenic
1172563350 20:35908556-35908578 CTGAATTTACAAATAAAAACTGG + Intronic
1173670281 20:44794063-44794085 CTGTCTCTAAAAATAAAGGCAGG + Intronic
1173984843 20:47253039-47253061 CTTTATTTGCAAACACAGGTGGG + Intronic
1174253786 20:49238907-49238929 AAGGATTTACAAATAAGGGTAGG - Intronic
1174307682 20:49626008-49626030 CTTTATTTACAAAAACAGGTGGG - Intergenic
1177103038 21:16918609-16918631 CTGGATTGACTAATAAAGGCCGG - Intergenic
1177342365 21:19820706-19820728 ATGTATTTAAAAATAAGAGTAGG + Intergenic
1178576775 21:33799787-33799809 TTCTGTTTACAAAAAAAGGTGGG - Exonic
1179102793 21:38369378-38369400 CTGTTTTTTCAAATAATTGTTGG + Intergenic
1179332247 21:40415192-40415214 CTGTATTTATATTTAAATGTAGG + Intronic
1180212905 21:46306205-46306227 TTGCATTTAAAAATAAAGGTAGG + Intronic
1181183983 22:21088391-21088413 ATGTTTTTAAAAATAAAGTTTGG - Intergenic
1181349751 22:22246520-22246542 CTGTATTTACAGAAACAGATGGG + Intergenic
1182141477 22:27963222-27963244 CTGAATTTACAAATAAAAATAGG + Intergenic
1184359325 22:44005029-44005051 CTTTATTTTGCAATAAAGGTGGG + Intronic
1184817714 22:46884710-46884732 CTTTATTTACAAAAATGGGTGGG + Intronic
949402751 3:3682920-3682942 CTGTCTTTAAAAAAAAAGGGGGG + Intergenic
949828587 3:8188919-8188941 CTATATTTAAAATTAAAGTTGGG + Intergenic
949837790 3:8287802-8287824 TTTTATTTACAAAAACAGGTTGG + Intergenic
950068088 3:10129656-10129678 CTGTCTTTAAAAATTAAGCTTGG + Intergenic
950247083 3:11430884-11430906 CTATTTTTAAAAATAAAAGTTGG + Intronic
951589892 3:24253053-24253075 CAGTGAATACAAATAAAGGTGGG + Intronic
952895733 3:38077578-38077600 CTGATTTGACAAATAAAGGCTGG + Intronic
953669015 3:44947078-44947100 CTGAATCTACAAATGATGGTAGG + Intronic
953977362 3:47392184-47392206 CTGTATTAAAAAATAAAAATAGG - Intronic
954939679 3:54360092-54360114 CATTATTTACAAAAAAAGGTGGG - Intronic
955005517 3:54965191-54965213 CTTTATTTACAAAAAGAGGCTGG + Intronic
955078552 3:55636751-55636773 CTTTATTTACAAAAACAGGCAGG + Intronic
955224754 3:57051519-57051541 TTGTAATTACAGATAAGGGTTGG + Intronic
956904433 3:73751004-73751026 CTTTATTTACAAACACAGGAAGG + Intergenic
959555117 3:107708133-107708155 TTCTATCTACAAATAAAAGTTGG - Intronic
960795021 3:121476337-121476359 TTTAATTTACAAATAAAGGAAGG - Intronic
962669243 3:137688340-137688362 CTGTATTTGCAAATAAATGTAGG + Intergenic
962730483 3:138278626-138278648 TTGTATTTATAAATAAATTTGGG + Intronic
963099978 3:141591849-141591871 CTGTATGTGAAAATACAGGTAGG - Intronic
963446551 3:145417108-145417130 CTATTTTTACAATTAAAGTTAGG - Intergenic
963971594 3:151436098-151436120 CTGCATTTAAAAATAAATGCAGG - Exonic
965644823 3:170869503-170869525 CGCAATTTACAAATAAAGTTAGG - Intronic
966489418 3:180510575-180510597 CTGGATGTAATAATAAAGGTAGG + Intergenic
966931057 3:184675894-184675916 CTGTATGTGCAAAGAAAGGGAGG + Intronic
967125111 3:186416230-186416252 CTTTATTTACAAAAAGTGGTGGG - Intergenic
967563172 3:190941665-190941687 CTATATTTAAAAATAAATATAGG + Intergenic
968257706 3:197292613-197292635 TAGTATCTACAAATAAAGATAGG + Intronic
968576686 4:1369450-1369472 CTGTTTTTTCAATTAAACGTGGG + Intronic
970732536 4:19123589-19123611 CTTTATTTACAAAAACAAGTGGG + Intergenic
970950911 4:21754285-21754307 CTGTATAGACAAATAAAGCAAGG - Intronic
971180792 4:24326990-24327012 CTGATTTGACTAATAAAGGTTGG - Intergenic
971244470 4:24915599-24915621 CGGTATTTAAAAATAAAGCTGGG + Intronic
971771413 4:30901816-30901838 GTTTATTTAAAAGTAAAGGTCGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
973535683 4:51879828-51879850 CTGTATTTGCTTATAAAGGAAGG - Intronic
973792562 4:54391864-54391886 CGGTAGTTAGAAAGAAAGGTTGG + Intergenic
974058404 4:57007645-57007667 CTGTATTTTCCAACAAAGGAGGG - Intronic
974722254 4:65755713-65755735 CTGAATGTACAAACTAAGGTAGG - Intergenic
975981739 4:80168992-80169014 CTGTATCTCCAAATACAGATGGG - Intergenic
977279292 4:95019506-95019528 ATGTTTTTAAATATAAAGGTGGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978262487 4:106777357-106777379 CTGTATTTATAGATAAATTTGGG - Intergenic
978994856 4:115138519-115138541 TTGTACTTCCAATTAAAGGTGGG + Intergenic
979721769 4:123908193-123908215 CTGTATTTTAAAATAAGGATTGG + Intergenic
979731545 4:124028987-124029009 TTGTTTTTACAAATACTGGTTGG - Intergenic
980464536 4:133155069-133155091 TTGTTTTTAAAAATAAACGTAGG + Intronic
980533847 4:134089684-134089706 CTGTATTTTCAATTCAAGTTTGG - Intergenic
981018381 4:139999609-139999631 CAGCATTTAAAAATAAATGTTGG - Intronic
982444676 4:155476404-155476426 ATGTATGTACAAAGAAAGCTTGG - Intergenic
982573926 4:157084707-157084729 CTGTATGTACTAAGAAGGGTAGG + Intronic
982940104 4:161539748-161539770 CTGTTTTTTTAAATAAAGGTGGG - Intronic
983649501 4:170024589-170024611 ATGTATTTAGAAATAAATTTAGG + Intronic
984664811 4:182414530-182414552 ATGCATTTAAAAATAAAGCTCGG - Intronic
984914470 4:184708935-184708957 CTTAATTTAGAATTAAAGGTGGG + Intronic
985572752 5:658557-658579 CTGAAATTACAAATAAATATGGG + Intronic
986398380 5:7354047-7354069 ATGTATTTGCAGATAAAGTTGGG - Intergenic
986534401 5:8771976-8771998 CAGTATTTACAAATAGGGTTTGG + Intergenic
986610292 5:9560323-9560345 CTTTATTTAGAAAAACAGGTGGG + Intergenic
987487148 5:18538081-18538103 CTGAATTGACTAATAAAGGCTGG - Intergenic
987933249 5:24429537-24429559 CAGTTTTTACAAAGAAAGATGGG + Intergenic
987968192 5:24904847-24904869 CTGAATTTCCAAATATCGGTGGG + Intergenic
988320477 5:29688473-29688495 CTGCATTTAAAAATAAAATTTGG - Intergenic
989198631 5:38741095-38741117 AAGGAGTTACAAATAAAGGTGGG - Intergenic
990556986 5:56946462-56946484 CTGTATTTTCAAATATAAATTGG - Intronic
990824145 5:59878482-59878504 CTATTTTTTCAAATACAGGTGGG + Intronic
990890888 5:60648845-60648867 CTTTCTTTATAAATAAAGGGTGG + Intronic
990897742 5:60717125-60717147 ATTTATTTACAAATAAATGTTGG - Intergenic
991003846 5:61808917-61808939 CTGTAATTAAAAATCAAGGGGGG - Intergenic
991568214 5:68027245-68027267 CTGTATTTAAAAAGCAAGATTGG - Intergenic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
992428253 5:76680931-76680953 TTGTATTTTTAAATAAAGATAGG - Intronic
992962450 5:81969971-81969993 CAGTTTTTACAAAGAAAGGCGGG - Intergenic
993109755 5:83642861-83642883 CTTCATTTACAAAAACAGGTAGG - Intronic
993477154 5:88379960-88379982 CTGTCTTTAAAAATAAAAGTAGG - Intergenic
994159124 5:96535913-96535935 CGGTTTTAACAAATAAAAGTAGG - Intronic
994409229 5:99385226-99385248 CAGTATTTAAAAATAACTGTAGG - Intergenic
994532238 5:100985548-100985570 CTGATTTGACTAATAAAGGTTGG + Intergenic
994793646 5:104265191-104265213 CTGTATTAACAAGTAAAAATAGG + Intergenic
995738001 5:115324059-115324081 ATGTGCTTAGAAATAAAGGTAGG + Intergenic
996310445 5:122098343-122098365 CTGTCTTTAAAAATAAAAATAGG - Intergenic
998051981 5:139043459-139043481 CTGTCTTTACAAAAACAAGTTGG + Intronic
998087255 5:139336558-139336580 CTGTCTCTAAAAAAAAAGGTGGG - Intergenic
999523510 5:152377452-152377474 CTTTATTTACAAAAACAGATTGG - Intergenic
1000259946 5:159578182-159578204 TTTTATTTACAAAAACAGGTGGG - Intergenic
1000606474 5:163333032-163333054 CTGTAGCTACAAGAAAAGGTGGG + Intergenic
1000903957 5:166940504-166940526 CTTTATTTACAAAAACAGGCGGG - Intergenic
1003332264 6:5139396-5139418 CTGTATTTACAAATACAAACTGG + Intronic
1003606559 6:7566778-7566800 CTTTATTTACAAATAGAAGTGGG + Intronic
1004589928 6:17040500-17040522 TTGTAATTAAAAATAAAGTTAGG + Intergenic
1005197356 6:23303261-23303283 CTGAATCTACAAATAAACTTGGG + Intergenic
1006654716 6:35581087-35581109 CTGTACTTACAAAAACAGGCAGG + Intronic
1007840161 6:44709515-44709537 CTTTATTTATAAAAACAGGTGGG - Intergenic
1008887210 6:56444379-56444401 CTGTATTTCCATATAGAGGGAGG - Intergenic
1010044557 6:71426035-71426057 ATGTATTTAAAAATAAATGTAGG + Intergenic
1010080072 6:71851243-71851265 ATATATTTAGAAATAAATGTTGG + Intergenic
1010286765 6:74087135-74087157 CTGTATTTTTAAAATAAGGTTGG - Intergenic
1010837778 6:80611694-80611716 TTTTATTTAAAAATATAGGTTGG + Intergenic
1012275169 6:97264419-97264441 CTATATTTGCAAATATAGCTAGG + Intronic
1012442682 6:99276216-99276238 GTGTATTTTCAATAAAAGGTTGG - Exonic
1012488751 6:99753388-99753410 CTGTATTTACAAATATACTTTGG + Intergenic
1012675481 6:102106915-102106937 CTGATTTGACTAATAAAGGTTGG - Intergenic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1013045935 6:106484982-106485004 CCCTATTTAAAAAAAAAGGTGGG + Intergenic
1013206467 6:107951038-107951060 ATGCACTTACAAATAATGGTTGG + Intronic
1013488060 6:110617232-110617254 CAGTTTTTACACAGAAAGGTAGG - Intronic
1013491987 6:110656508-110656530 ATGTATTTACAACTATATGTAGG + Intronic
1014240039 6:119007339-119007361 CTGTATTTACAAGGAAAAATAGG - Intronic
1014884306 6:126760906-126760928 CTGTATTTAGTAATAACTGTGGG + Intergenic
1014916969 6:127162442-127162464 CTGTTTTTACAAAGGAAGGAAGG - Intronic
1014927664 6:127293683-127293705 TTATATTTCCAAATAAAAGTAGG - Intronic
1015172837 6:130273175-130273197 ATATATTTACAAATGATGGTAGG + Intronic
1015957791 6:138616016-138616038 CTGTTTTAAAAAATAAAGATGGG - Intronic
1016110421 6:140217015-140217037 GTGTCTTTACAAATAAAGTGAGG + Intergenic
1017136547 6:151152329-151152351 CTGTTTTTACAAATAAATCCTGG + Intergenic
1017527646 6:155256003-155256025 CTGTCTTTAAAAAAAAAGGGGGG + Intronic
1017692953 6:156985029-156985051 CTTCATTTCCAAATAAAAGTAGG + Intronic
1017984634 6:159432817-159432839 CTGTATTAAAAAATTAAAGTAGG - Intergenic
1018372780 6:163183620-163183642 CTGTAGGTATAAATCAAGGTTGG - Intronic
1019993017 7:4705350-4705372 CTGTCTTTACAAAAAAAAGTTGG - Intronic
1020829487 7:13076019-13076041 CTGGATATGGAAATAAAGGTTGG + Intergenic
1021096042 7:16537269-16537291 CTGTACTTTCAAGTAAATGTGGG - Intronic
1021535286 7:21697113-21697135 TTATATTTACAAAAACAGGTAGG + Intronic
1021582998 7:22176918-22176940 CTGTATTTAAAAATACTGCTAGG + Intronic
1021693162 7:23249216-23249238 TTGAATTTAAAAATAAAGGCCGG - Intronic
1023571290 7:41574983-41575005 CTCTATTTTAAAATAAATGTGGG - Intergenic
1024478810 7:49842900-49842922 CTGAATCTAAAAATAAAAGTTGG - Intronic
1024841765 7:53595232-53595254 GAGTATTTACAAAGCAAGGTCGG + Intergenic
1025205441 7:56990876-56990898 CAGTATTTAAAAAAAAAAGTGGG - Intergenic
1025297266 7:57785721-57785743 ATGTATATACAAATATAGGTTGG + Intergenic
1025298034 7:57792355-57792377 ATGTATATACAAATATAGGTTGG + Intergenic
1028456352 7:91042109-91042131 CTGAAGCTACAAATAGAGGTAGG + Intronic
1028712111 7:93921491-93921513 CTCTAATTACATATATAGGTTGG - Intergenic
1028875813 7:95822506-95822528 CTGTATTTTGAAATGAAGTTAGG + Intronic
1028885833 7:95931623-95931645 CTTTATTTACAAAAACAGGTAGG - Intronic
1029128243 7:98310149-98310171 ATCTATTTACAAATAAATGGAGG - Intronic
1030278160 7:107742431-107742453 CTGTATTTAGAAAAATAGGGAGG + Intergenic
1030678938 7:112413863-112413885 CTGTATTCACAATTGAAGTTGGG + Intergenic
1030724923 7:112916255-112916277 CTGTGATGACTAATAAAGGTAGG + Intronic
1031708579 7:125014359-125014381 CTGAATTTACAACTAGATGTAGG + Intergenic
1032199082 7:129806443-129806465 CAGTATTTAAAAATAATGGCTGG + Intergenic
1033539294 7:142341435-142341457 GTGAATTGACAAATAAAAGTTGG - Intergenic
1033952265 7:146799372-146799394 CTGTGTATACAAATAAAAATGGG - Intronic
1034135210 7:148761730-148761752 CTTTATTTACAGAAAAAGGCAGG + Intronic
1034307200 7:150053813-150053835 CTGCAGTTACAAATAAAGGAAGG + Intergenic
1034783663 7:153905181-153905203 CAGTTTTTACACAGAAAGGTGGG + Intronic
1034799647 7:154046870-154046892 CTGCAGTTACAAATAAAGGAAGG - Intronic
1035075683 7:156175852-156175874 CTTTATTTACAAAGATAGATGGG + Intergenic
1035319861 7:158021850-158021872 CTTTATTTACTAAAACAGGTGGG + Intronic
1035427311 7:158788269-158788291 CTGTATTCAAAAATAAAATTAGG - Intronic
1035941843 8:3909993-3910015 CTTTATTTATAAATAAATGGAGG - Intronic
1036186228 8:6624728-6624750 CGCTATGTACAAATAAAGGAAGG + Intronic
1036998013 8:13682104-13682126 CTGTGTTAAGAAATGAAGGTAGG + Intergenic
1038033666 8:23667121-23667143 CTCTAATTACAAATAATGTTTGG + Intergenic
1039073920 8:33671617-33671639 CTTTATTTTCAAACAAAGGAAGG + Intergenic
1039314868 8:36360210-36360232 CTTTATTTACAAACAGACGTGGG + Intergenic
1040450017 8:47536217-47536239 CTGAATCTACAAATCAAGTTGGG - Intronic
1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG + Intergenic
1041554145 8:59134115-59134137 GGGTATTTTCCAATAAAGGTAGG + Intergenic
1042178741 8:66063328-66063350 CTGTAATTGCTAATAAAGATGGG - Intronic
1042435470 8:68759593-68759615 CTGAATTTACATATACATGTGGG + Intronic
1044403695 8:91801492-91801514 CTGCATTTAGAGACAAAGGTAGG - Intergenic
1044417999 8:91957954-91957976 CTGTATTTTCATATACAAGTTGG - Intronic
1044914114 8:97093968-97093990 GAGTCTTTACAAATAAAGGTAGG + Intronic
1045216480 8:100154114-100154136 CTGTATTTTCATATAATGCTTGG + Intergenic
1046596353 8:116265633-116265655 CTTTATTTGCAAAAACAGGTGGG + Intergenic
1046964261 8:120145774-120145796 CTGTATTTCCAAATAAAAGTAGG + Intronic
1047660920 8:127035729-127035751 TTGTATTTACACATACATGTAGG - Intergenic
1048118605 8:131553764-131553786 CTGTACTTAGGAATAAAGGTAGG + Intergenic
1048157292 8:131969639-131969661 TTTTATTGTCAAATAAAGGTGGG + Intronic
1048339611 8:133528596-133528618 CTTCATTTACAAAAATAGGTGGG - Intronic
1048522907 8:135173400-135173422 CTTTATTTACAAAGAGAAGTGGG + Intergenic
1051040584 9:12804897-12804919 AAGTATTTACAAAAACAGGTGGG - Intronic
1051080903 9:13292251-13292273 ATTTATTTACAACTAAATGTTGG + Intergenic
1051264177 9:15295322-15295344 CTTTATTTACAAAAATAGGCAGG + Intronic
1051782994 9:20710925-20710947 CTTTATTTACAAAAAGAAGTGGG - Intronic
1052583155 9:30388257-30388279 CTGTATTTCCAAACACAGGTAGG - Intergenic
1052637976 9:31126857-31126879 CTGTTTTGACAAATATAGCTTGG - Intergenic
1053408601 9:37900136-37900158 CTGTCTTTAAAAATAAAAATAGG - Intronic
1053795568 9:41723684-41723706 ATGTATATACAAATATAGGTTGG - Intergenic
1053798956 9:41751462-41751484 ATGTATATACAAATATAGGTTGG - Intergenic
1054146254 9:61563491-61563513 ATGTATATACAAATATAGGTTGG + Intergenic
1054149616 9:61591192-61591214 ATGTATATACAAATATAGGTTGG + Intergenic
1054183978 9:61935739-61935761 ATGTATATACAAATATAGGTTGG - Intergenic
1054187371 9:61963521-61963543 ATGTATATACAAATATAGGTTGG - Intergenic
1054465986 9:65494582-65494604 ATGTATATACAAATATAGGTTGG + Intergenic
1054469380 9:65522302-65522324 ATGTATATACAAATATAGGTTGG + Intergenic
1054651143 9:67625009-67625031 ATGTATATACAAATATGGGTTGG + Intergenic
1054654527 9:67652747-67652769 ATGTATATACAAATATAGGTTGG + Intergenic
1055048187 9:71952666-71952688 ATGTATTAAAAAATAAAGGCAGG - Intronic
1055590480 9:77807943-77807965 CTATTTTTATAAATAAAGTTTGG - Intronic
1056079640 9:83078309-83078331 TTATATTTACAAATCAAGGCAGG - Intergenic
1056638810 9:88352735-88352757 CAGTTTTTACACAGAAAGGTGGG - Intergenic
1058243953 9:102601784-102601806 CTAAATTCACTAATAAAGGTAGG - Intergenic
1058431108 9:104920190-104920212 CTGTAATTACACATAAAATTTGG + Intronic
1058467885 9:105246105-105246127 TTGTTTTTAGAAATAAAGGATGG + Intronic
1058485390 9:105439115-105439137 CTTTATTTACAAAAATAGCTGGG - Intronic
1058637586 9:107051365-107051387 CTTTATTTACAACAACAGGTGGG + Intergenic
1060055481 9:120409365-120409387 CTGTATTTATATAATAAGGTTGG - Intronic
1060251669 9:121991220-121991242 CTTTATTTAGAAATATAGGCTGG - Intronic
1186134616 X:6505914-6505936 CTGTTTTTACACAGAAAGGTAGG + Intergenic
1186328233 X:8503036-8503058 CTGAATCTACAAATAAAGGAAGG + Intergenic
1186588982 X:10908816-10908838 CTATATTTTTAAATAAAGATTGG - Intergenic
1186829917 X:13379824-13379846 CAGTATTTACACAGAAAGCTGGG + Intergenic
1187138727 X:16573074-16573096 CTTTATTTACAAAAATAGGCAGG + Intergenic
1188366710 X:29324593-29324615 CAGTTCTTACACATAAAGGTAGG + Intronic
1188411858 X:29882650-29882672 CTTTATTTACAAAAACAGGCAGG + Intronic
1190238918 X:48641504-48641526 ATTTATTTAAAAATAAATGTAGG - Intergenic
1191990986 X:67036876-67036898 CTGGATTGAAAAAAAAAGGTGGG + Intergenic
1192210208 X:69123136-69123158 CTGTGTGTACAAATACAGCTTGG - Intergenic
1192860422 X:75063147-75063169 TTGTATTTAGGAATAAATGTGGG - Intronic
1193274716 X:79571445-79571467 CTATACTTAAAAATAAAGTTGGG - Intergenic
1193929823 X:87539920-87539942 GTGTATTTACAAACCAAGATGGG + Intronic
1194271247 X:91819085-91819107 CTTGATTTATAAATAAAAGTGGG + Intronic
1195238847 X:102930998-102931020 CCCTATTTCCAAATAAAGTTTGG - Intergenic
1196294529 X:113982941-113982963 CTGTATTTGCAAAATAAGGCTGG - Intergenic
1196674617 X:118406262-118406284 CTGTATTTTCAAAATTAGGTAGG + Intronic
1197106611 X:122724118-122724140 CTGTTTTTGCAAATAAAGTTTGG - Intergenic
1200853234 Y:7908185-7908207 TTGTATTTCCAAAAAAAAGTGGG + Intergenic
1200921022 Y:8613530-8613552 CTGTATCTAGAAATAACAGTGGG - Intergenic
1202130516 Y:21604824-21604846 CTGTACTTAGAAATAACAGTTGG + Intergenic
1202179029 Y:22123714-22123736 CTGTAGTTAGAAATCAAAGTGGG + Intergenic
1202212332 Y:22462680-22462702 CTGTAGTTAGAAATCAAAGTGGG - Intergenic