ID: 1110112564

View in Genome Browser
Species Human (GRCh38)
Location 13:71766275-71766297
Sequence CTAAGGTACTTAAAGGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110112564_1110112567 -4 Left 1110112564 13:71766275-71766297 CCTGTAGCCTTTAAGTACCTTAG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1110112567 13:71766294-71766316 TTAGAATCTATAATCACTTGTGG 0: 1
1: 0
2: 0
3: 8
4: 168
1110112564_1110112569 21 Left 1110112564 13:71766275-71766297 CCTGTAGCCTTTAAGTACCTTAG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1110112569 13:71766319-71766341 ATGTTTAAAATTCCAATGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 270
1110112564_1110112568 17 Left 1110112564 13:71766275-71766297 CCTGTAGCCTTTAAGTACCTTAG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1110112568 13:71766315-71766337 GGAGATGTTTAAAATTCCAATGG 0: 1
1: 0
2: 0
3: 21
4: 252
1110112564_1110112570 22 Left 1110112564 13:71766275-71766297 CCTGTAGCCTTTAAGTACCTTAG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1110112570 13:71766320-71766342 TGTTTAAAATTCCAATGGCCGGG 0: 1
1: 0
2: 2
3: 37
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110112564 Original CRISPR CTAAGGTACTTAAAGGCTAC AGG (reversed) Intronic
903292589 1:22324220-22324242 CTGAGGCACTTAGAGGCTACGGG + Intergenic
905269153 1:36775465-36775487 CTAAGGCACTGAAAGACAACTGG - Intergenic
905867539 1:41384308-41384330 TTAAGGAACTTAGAGGCTCCTGG + Intergenic
905944488 1:41890292-41890314 CCAAGGTACTTACAGCCTAAAGG + Intronic
910052161 1:82987754-82987776 GTAAGGTAGCTAATGGCTACAGG - Intergenic
912394283 1:109328818-109328840 TTAAGAAACTTAAAGGCTCCAGG + Intronic
915925778 1:160018323-160018345 CTAAAGGACTTAAAGGATACTGG - Intergenic
917283107 1:173397826-173397848 CTAAGATACTTCAAGGATGCAGG + Intergenic
1066112963 10:32213496-32213518 CAAAGGCACTTAGAGGCTAGTGG - Intergenic
1072150278 10:92677315-92677337 CTATGCTACTTAAAGGACACTGG + Intergenic
1078357913 11:10646618-10646640 CTCAGTTACTTAAAAGTTACGGG + Intronic
1080841256 11:35985465-35985487 CCCAGGTACTAAAAGGCTCCAGG - Intronic
1082054571 11:47802849-47802871 CTGAGGTACTTGGAGGCTACAGG - Intronic
1087041284 11:93802885-93802907 AAAAAGTCCTTAAAGGCTACTGG - Intronic
1087784493 11:102339643-102339665 CAAAGGAACTTAATGGCTAATGG - Intergenic
1089297482 11:117478786-117478808 CTTGGGTACTGAAAGGCAACAGG - Intronic
1090594432 11:128306163-128306185 CCAAGGAACTTACAGTCTACTGG + Intergenic
1099528942 12:83751607-83751629 ATAATGTACTTAAAGTTTACTGG + Intergenic
1103774988 12:123360810-123360832 GTAAGGCACTTAAAACCTACAGG + Intronic
1104312759 12:127669162-127669184 CTCAGATACTTCAAGGCTGCAGG + Intergenic
1108091730 13:46856570-46856592 CTAAGAGAGTTAAAGCCTACTGG - Intronic
1110112564 13:71766275-71766297 CTAAGGTACTTAAAGGCTACAGG - Intronic
1111534933 13:89591327-89591349 CTATAATACTTAAAGTCTACAGG - Intergenic
1112390613 13:98980580-98980602 ACAAGGCACTTAAAGGCTAAAGG - Intronic
1114193540 14:20458472-20458494 CTGGGGTAGTTAAAGGCTCCCGG - Exonic
1118360478 14:65052602-65052624 CTAAGGTACTGACAAGCAACTGG - Intronic
1119825618 14:77654989-77655011 CTAAGGGACTTAAAGGCATGTGG + Intergenic
1120632726 14:86910607-86910629 CTAAGGAACTAAAAGGCTATTGG - Intronic
1121018444 14:90563044-90563066 CTCTGGTACTGAAAGGCTATAGG - Intronic
1130369726 15:83274833-83274855 GTAAAGAACTTACAGGCTACTGG + Intronic
1140746449 16:77984714-77984736 ATAAGGTACTTAAAGCACACAGG + Intergenic
1146592632 17:34141275-34141297 CTAAGGTCCTTCATGGCTAAAGG - Intronic
1151411155 17:73930693-73930715 CTCAGTTACTTAAAGGCATCAGG - Intergenic
1156040799 18:32819975-32819997 CTATGGTACTTAGTGGGTACAGG + Intergenic
1158065859 18:53407275-53407297 CTTATGTACTTACAGGCTAAAGG + Intronic
1165114397 19:33520540-33520562 TTAAGGTACTCACAGGCCACTGG - Intronic
925200357 2:1962952-1962974 CGAATGTACTTAATGGCAACTGG + Intronic
927313282 2:21653959-21653981 TTAAGATAATTATAGGCTACAGG + Intergenic
928683062 2:33722558-33722580 GTCAGGCACTTAAAGGGTACAGG - Intergenic
938031979 2:128002793-128002815 ATAAAGTACTCAAAGGCTAACGG + Intronic
939249522 2:139666547-139666569 CTCAGGAAGTTAAAGGCTAATGG + Intergenic
942640299 2:178054093-178054115 CTACTGTACTACAAGGCTACAGG + Intronic
947085833 2:226451682-226451704 CTCAGGAACTCAAAGGCTAGGGG + Intergenic
1169628107 20:7595683-7595705 CTATGTTTCTTAAAGGATACAGG + Intergenic
1169933555 20:10858797-10858819 CTAAGGTACTTAGGGGCCAGTGG + Intergenic
1170302558 20:14901819-14901841 CTAAGGTTCTTTAGGGCTATAGG + Intronic
1171954431 20:31449595-31449617 GAAAGGCACTTAAAGACTACAGG + Intronic
1173718458 20:45231710-45231732 CTAAGGTACTCAATAGTTACTGG + Intergenic
1174913284 20:54629840-54629862 CTTTGGCACTTAAAGGCTCCTGG - Intronic
1177542998 21:22520217-22520239 CTAGGGAACTCCAAGGCTACTGG + Intergenic
1182190031 22:28450025-28450047 CTAAGGTACTTAGAGGCACAGGG + Intronic
949839886 3:8308142-8308164 CCAAGGAACTTACAGTCTACTGG - Intergenic
951345883 3:21546763-21546785 CTAGGGAACTCCAAGGCTACTGG + Intronic
953466562 3:43126781-43126803 CTAAGGCACTTAAAGGAAAGTGG - Intergenic
956027631 3:65000563-65000585 ATAAGGTACTTATGTGCTACTGG - Intergenic
960322620 3:116254930-116254952 CTAAGGTACTTAAAGATTAAAGG + Intronic
964078689 3:152724190-152724212 CTTAGGGACTTAAAGGCTGCAGG + Intergenic
971808360 4:31390866-31390888 GTAAGTTACTTAAATGTTACAGG - Intergenic
972362672 4:38342801-38342823 CTAAGGTTCTCAAACGCTAGTGG - Intergenic
974135373 4:57810175-57810197 CTAAGGAACTTGAAGGGTAGGGG - Intergenic
976610712 4:87027510-87027532 CTAGGGTATTTACAGGCTTCTGG - Intronic
979546108 4:121941867-121941889 CTGGTGTACTTAATGGCTACTGG - Intronic
981729878 4:147886046-147886068 CAAAGTTACCTACAGGCTACAGG + Intronic
992125108 5:73631871-73631893 CTAAGTTAGTTGAAGGTTACAGG - Intronic
996792950 5:127312700-127312722 CCAAGGTACTTATAGGAAACTGG - Intronic
997096731 5:130921855-130921877 CTAAGATATTTAAAGTCTGCTGG - Intergenic
1003329485 6:5117947-5117969 AGAAGGTACTCAAAGGCAACAGG - Intronic
1003828381 6:9977396-9977418 TTAAGGTAATTAAAGCCTGCAGG - Intronic
1011901031 6:92298411-92298433 ATAAGCTACTTAAAGGTTATAGG - Intergenic
1016172349 6:141034138-141034160 ATATGGTACTTAAATGTTACTGG + Intergenic
1016391054 6:143576192-143576214 CAAAGGTAATTAAAGGATTCAGG - Intronic
1021477782 7:21082161-21082183 TCAAGGTACTAAAAAGCTACTGG + Intergenic
1022212434 7:28224681-28224703 CCAAGGTACTTAAGGACTAGAGG - Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1027551043 7:79595612-79595634 TTAAGCTACTTGAAGGCTTCAGG + Intergenic
1028343807 7:89755533-89755555 CCAAGGTCCTTAAATACTACAGG + Intergenic
1041245178 8:55881988-55882010 CTAAGGTGTTTGAAGCCTACTGG + Intronic
1042883543 8:73522227-73522249 CTAATGTAATTAAAGGAGACAGG + Intronic
1050431127 9:5562906-5562928 CTCAGGCACTTAAAGGCTGAGGG - Intronic
1052981539 9:34453567-34453589 ATCAGGTACTTTAAGGATACAGG - Intronic
1054716031 9:68558679-68558701 CTATGTTACTTAAAAGCAACTGG - Intergenic
1055258751 9:74406586-74406608 CTATGGTATTTATATGCTACTGG + Intergenic
1055423588 9:76169819-76169841 CTAAGGAACTTTAAGACTCCAGG + Exonic
1055981323 9:82005101-82005123 AGAAGGTACTCAAAGGCTATTGG - Intergenic
1056056504 9:82829284-82829306 ATAAGATACTAAAAGGTTACAGG + Intergenic
1056874847 9:90318408-90318430 CTAAGGTCCTTACTGGCTGCTGG + Intergenic
1188021188 X:25159527-25159549 CTAAGGTACCTCAAAGCTTCTGG - Intergenic
1188726581 X:33591600-33591622 ATAAGGAACTTGAGGGCTACAGG - Intergenic
1189404281 X:40705522-40705544 CTAAAGCATTTAAAGGCAACAGG + Intronic
1193798438 X:85905996-85906018 CTAAGGAACTTACAGTCTACTGG - Intronic
1194860621 X:98994278-98994300 GTAAGGTATATAAAGGCTTCGGG - Intergenic
1195811032 X:108830127-108830149 CCAAGGTACATACAGACTACAGG - Intergenic
1198161180 X:134010288-134010310 TCAAGGTACTTAAAGTCTAGTGG - Intergenic