ID: 1110115766

View in Genome Browser
Species Human (GRCh38)
Location 13:71814920-71814942
Sequence CAGCACTTCAACTAACAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110115766 Original CRISPR CAGCACTTCAACTAACAAGT TGG Intronic
903623595 1:24715409-24715431 CAGCCCTTCCAGTAACAACTGGG + Intergenic
913687611 1:121248074-121248096 CAGCACTTCACATCACAAGATGG - Intronic
914039473 1:144035719-144035741 CAGCACTTCACATCACAAGATGG - Intergenic
914149986 1:145032217-145032239 CAGCACTTCACATCACAAGATGG + Intronic
917613604 1:176715057-176715079 CAGAGTTTCACCTAACAAGTAGG - Intronic
920612554 1:207455494-207455516 CAGCATTTAAGCTAACAAGCTGG + Intronic
921960093 1:221025466-221025488 CAGCACATCTGCCAACAAGTGGG - Intergenic
924442425 1:244097228-244097250 CAGCACTTCAGCTTTCCAGTGGG - Intergenic
1068050111 10:51939724-51939746 CAGCATTTTAACTTACCAGTGGG + Intronic
1068076608 10:52263790-52263812 CATCACTTGAGCTCACAAGTTGG - Intronic
1068887404 10:62111699-62111721 CAGCTCTGCAACTCACAAGCTGG - Intergenic
1072844036 10:98808539-98808561 CAGCCCTTCAACTAACACTTAGG + Intronic
1080930486 11:36805073-36805095 CGCCACTTCTACTAACAACTTGG - Intergenic
1082199358 11:49345023-49345045 GTGCCCATCAACTAACAAGTAGG - Intergenic
1084685128 11:70688894-70688916 CAGCACTTCAATTTTCAATTTGG + Intronic
1085538832 11:77246810-77246832 CAGCATTTCACCTAACACATGGG + Intronic
1086413794 11:86568983-86569005 CAGCACTTCATTTAATAAGTGGG - Intronic
1087083373 11:94193498-94193520 CAGCACATCAACTGAGAAGCTGG + Intergenic
1087809720 11:102597267-102597289 CAAAACTTCAACTAAAAAGTAGG - Intronic
1088212068 11:107467501-107467523 CAGTTCTTCATCTAAAAAGTAGG - Intergenic
1088316690 11:108514213-108514235 GAGCATTTAAACTAACACGTTGG + Exonic
1092050451 12:5465982-5466004 CAGCTCTACCACTTACAAGTTGG - Intronic
1093273913 12:17100260-17100282 CAGCACTGCCACAATCAAGTCGG + Intergenic
1093528005 12:20125889-20125911 CAGAGCTTCAAGTAAGAAGTGGG - Intergenic
1097087797 12:56481588-56481610 AAGCACTTGAAATAAGAAGTAGG + Intronic
1103867415 12:124063995-124064017 CAGCACTGCAAGTAAGAAGAGGG + Intronic
1108875895 13:55050421-55050443 AAAAACTTCAACTAAAAAGTGGG + Intergenic
1110115766 13:71814920-71814942 CAGCACTTCAACTAACAAGTTGG + Intronic
1114711234 14:24780560-24780582 CAGCACATCAGCTAAAAAATGGG - Intergenic
1115646892 14:35374521-35374543 CAGCACTTCATTTCACAAGGAGG + Intergenic
1122502081 14:102207496-102207518 CACCGCTTCACCTAACAGGTGGG - Intronic
1122578255 14:102755370-102755392 CAGGACTCCAACTGGCAAGTGGG - Intergenic
1122624856 14:103079356-103079378 TACCACTTGCACTAACAAGTTGG + Intergenic
1127741606 15:61913243-61913265 CTACAGTTCAACAAACAAGTTGG - Intronic
1131194510 15:90344770-90344792 CAACACTTCAAAAAAGAAGTAGG - Intergenic
1131516985 15:93085814-93085836 CAGCACTTCTACTCACAGGACGG + Intronic
1143302061 17:5917795-5917817 CAGAACTTCAACTGACCAGCTGG - Intronic
1143856052 17:9850440-9850462 CTGCATTTCAACGAACAAGTGGG - Intronic
1143987627 17:10928733-10928755 CCCCACTTCGACTAACTAGTGGG + Intergenic
1146991121 17:37273654-37273676 CAGCACTGCCAGTAACCAGTGGG + Intronic
1153720150 18:7893615-7893637 CAGGAATTAAACAAACAAGTGGG - Intronic
1157479775 18:48045957-48045979 CACCCATTCAACTAGCAAGTTGG - Intronic
1158420098 18:57285690-57285712 CACCACCTGAACTAACCAGTAGG + Intergenic
936339639 2:111619471-111619493 CAGCACTGCCACAAACACGTGGG - Intergenic
936484048 2:112911435-112911457 GAGGGCTTCCACTAACAAGTAGG + Intergenic
936775514 2:115967587-115967609 CAACACTTCAAGTATTAAGTTGG - Intergenic
937047718 2:118860790-118860812 CAGCCCTTCACCTATAAAGTGGG + Intergenic
939301459 2:140346146-140346168 CAGCACCAAAAGTAACAAGTAGG + Intronic
944900748 2:204213105-204213127 CAGCACTTCACCTCACACTTGGG - Intergenic
1170692872 20:18631023-18631045 TAGCACTTCATCTAACATGGAGG - Intronic
1171120213 20:22562126-22562148 CAGCATTGCAGATAACAAGTAGG - Intergenic
1172269778 20:33648081-33648103 CAGCACCTCAGCTACCAGGTGGG + Exonic
1174950844 20:55040343-55040365 CAGCACTACAACTGACACATAGG - Intergenic
1177500313 21:21946468-21946490 CAGCATTCCAACTAACAGGAGGG + Intergenic
1181337514 22:22150351-22150373 CAGCACTGAAACTTAGAAGTTGG - Intergenic
1182411193 22:30188303-30188325 CAGAAATTCAATTAACAAGGAGG - Intergenic
949937145 3:9124713-9124735 CACCAGTTCAAGTAAGAAGTTGG - Exonic
959040431 3:101415826-101415848 TATCACTTCAAGTAATAAGTTGG - Intronic
959137608 3:102443876-102443898 AAGCACTACCACTAAAAAGTAGG - Intronic
960257286 3:115524241-115524263 CAACACCTTACCTAACAAGTAGG - Intergenic
962484799 3:135831991-135832013 CAGGACTTCAAGTAACAGGATGG + Intergenic
966838753 3:184070553-184070575 CAGCACTGCAACAAACATTTGGG - Intergenic
973954718 4:56050732-56050754 GATCACTTCAACTCAGAAGTGGG + Intergenic
975102057 4:70524955-70524977 CAGCTGTTCAACTTACATGTGGG - Exonic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
978591864 4:110332382-110332404 CTGGACTTCAACTATGAAGTTGG - Intergenic
979062230 4:116078308-116078330 CAGCAGTACAACAAAGAAGTGGG - Intergenic
980214088 4:129828665-129828687 CAGAACTTCAACATATAAGTTGG + Intergenic
980416836 4:132500044-132500066 TAGCACTTCAACAAACATGGTGG + Intergenic
981240457 4:142470379-142470401 CAGTATTTCATCTAACAAATTGG + Intronic
985661379 5:1158787-1158809 CAGCACTTCAACTCCCCAGGCGG - Intergenic
987016371 5:13824072-13824094 CAGCACTTTATCTGACAATTAGG + Intronic
1002152042 5:177241760-177241782 CAGGACTTCAACAATGAAGTAGG - Intronic
1006919558 6:37618544-37618566 CAGCACATCACCTAGCACGTGGG + Intergenic
1010502452 6:76617444-76617466 CAGTATGTCAAGTAACAAGTAGG - Intergenic
1010535679 6:77026595-77026617 CAGCTCTTCAAATAACTAATGGG - Intergenic
1012733706 6:102912286-102912308 AAGCACCTCAACTACTAAGTAGG + Intergenic
1012744162 6:103062394-103062416 CAGCTCTTAAACCAACAATTTGG + Intergenic
1012958009 6:105591442-105591464 CAGCACTTCCCCTATCAACTTGG + Intergenic
1013717543 6:112980346-112980368 CAGCACTATAATTAAGAAGTGGG + Intergenic
1017219753 6:151952146-151952168 CAGCACTTCAATTAACAGTTTGG + Intronic
1022043753 7:26606281-26606303 AAACACTTCAATTAAAAAGTGGG + Intergenic
1023810454 7:43907000-43907022 CAGCACTGCAAGTAAGAAGTAGG - Exonic
1027112745 7:75453869-75453891 CAGGACTTCAACTGACCTGTGGG + Intronic
1027284991 7:76638480-76638502 CAGGACTTCAACTGACCTGTGGG + Intergenic
1041196270 8:55404595-55404617 CAGAAATTAAAATAACAAGTGGG - Intronic
1044199688 8:89419260-89419282 CAGCACTTCCACTAATATCTAGG - Intergenic
1045335576 8:101200936-101200958 CAGCTCTTCTACTAACCAGCTGG + Intronic
1048472591 8:134716868-134716890 CAGAACTTCAAGTAAGAAATAGG - Intergenic
1060469215 9:123933289-123933311 CAGAACGTGAACAAACAAGTTGG - Intergenic
1191041849 X:56090185-56090207 CACCACATCAACTAACAACATGG + Intergenic
1191571861 X:62636129-62636151 CAGCACTTCAAATATCCACTTGG - Intergenic
1194712131 X:97248788-97248810 CAGCACTGTAACTTCCAAGTTGG - Intronic
1195479652 X:105329198-105329220 CAACACTTCATGTAACAAATGGG - Intronic