ID: 1110116073

View in Genome Browser
Species Human (GRCh38)
Location 13:71818239-71818261
Sequence ATGCTATAATTAGGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 378}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110116073 Original CRISPR ATGCTATAATTAGGGAAAAC AGG Intronic
901725040 1:11235084-11235106 CTGCTATGACTGGGGAAAACAGG - Intronic
902228383 1:15011567-15011589 ATGCAATAAGTAGGTAACACAGG - Intronic
902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG + Intergenic
902421058 1:16280570-16280592 ATGCTAACATTAGGGAAACTGGG + Intronic
903708484 1:25304309-25304331 AACCTAAAATTAGGAAAAACTGG + Intronic
903718630 1:25388104-25388126 AACCTAAAATTAGGAAAAACTGG - Intronic
903797247 1:25938659-25938681 ATGTTATATTTGGGGAAAACTGG - Intergenic
904985406 1:34543887-34543909 ATGTTAATAATAGGGAAAACTGG + Intergenic
907066651 1:51490935-51490957 ATGTTACAATTAGGGAAAATTGG + Intronic
907297423 1:53464299-53464321 TTGCTGTAATTATGAAAAACAGG - Intronic
908663746 1:66466183-66466205 ATACTATGATTTGGGAAATCTGG - Intergenic
909504774 1:76376203-76376225 ATGTTATCATTGGAGAAAACTGG - Intronic
909523363 1:76594912-76594934 ATGCTAATAATAGGGAAAACAGG - Intronic
909553217 1:76923157-76923179 ATGTTACAATTGGGGAATACTGG + Intronic
910988631 1:93031077-93031099 CTGCTCTAATTAGGAAACACTGG + Intergenic
912006836 1:104914060-104914082 ATGCTAAAATTAGAGATAATAGG - Intergenic
912278220 1:108283484-108283506 AAGCTATAAATAGGGAGAAGAGG + Intergenic
912290006 1:108410873-108410895 AAGCTATAAATAGGGAGAAGAGG - Intronic
912377426 1:109222269-109222291 ATGTTATCATTGGGGAAAACGGG - Intronic
913717199 1:121548180-121548202 TTGCTACAATTAGTGAAGACTGG - Intergenic
915710753 1:157895866-157895888 ATGTTACAATTGAGGAAAACTGG - Intronic
916086920 1:161277446-161277468 ATTTTATAGTTAAGGAAAACAGG - Intronic
916255623 1:162784788-162784810 ATGTTATAAATGGGGAAAACTGG - Exonic
916724714 1:167512607-167512629 ATGCAATAATGGGGGAACACTGG - Intronic
917705535 1:177630335-177630357 ATGTTACTATTAAGGAAAACTGG + Intergenic
919556602 1:199063011-199063033 ATGGTATGATTAGGGAAAATAGG + Intergenic
919719979 1:200823359-200823381 ATGTTAACATTAGAGAAAACTGG - Intronic
919839796 1:201600553-201600575 ATTCTAAAATTAGGGGAAACTGG + Intergenic
920402572 1:205685623-205685645 ATGTTAACATTAGGGGAAACTGG + Intergenic
922400432 1:225248780-225248802 TTACTATAACTAGGGAAAAGGGG + Intronic
923644116 1:235798363-235798385 ATGTTAATAATAGGGAAAACTGG + Intronic
923720797 1:236465062-236465084 ATGCGATCACTGGGGAAAACAGG - Intronic
923972130 1:239216555-239216577 ATTCTTTAACTAGGGAAAGCTGG + Intergenic
923994336 1:239475688-239475710 ATGCTAATAATAGGGAAAACTGG + Intronic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924641257 1:245835753-245835775 ATGGGATCATTAGGAAAAACAGG + Intronic
924734167 1:246739627-246739649 ATGTTAAAAATAGAGAAAACTGG + Intronic
1063099818 10:2939987-2940009 TTGGTATAATAAGAGAAAACTGG - Intergenic
1066722086 10:38350457-38350479 ATGTTGTAAATGGGGAAAACTGG - Intergenic
1067100695 10:43332336-43332358 ATGTTATCATTGGGGGAAACTGG + Intergenic
1067735852 10:48849700-48849722 ATGTTAACAATAGGGAAAACTGG - Intronic
1068593552 10:58875966-58875988 ATGATAACATGAGGGAAAACTGG + Intergenic
1070233501 10:74597320-74597342 ATGTTAATATTAGGGTAAACTGG - Intronic
1071488449 10:86119448-86119470 AAGCTAAAAATGGGGAAAACTGG + Intronic
1071932652 10:90490264-90490286 ATGTTAACATTAGGGAAAACTGG - Intergenic
1072230875 10:93413019-93413041 ATGCTATAATTATGGCAAGGAGG - Intronic
1073692465 10:105825307-105825329 AAGTTATTATTAGGGGAAACTGG + Intergenic
1073980890 10:109152310-109152332 ATGTTACCATTGGGGAAAACTGG - Intergenic
1075335749 10:121607869-121607891 ATGCTTTAATTAGGAAATGCTGG - Intergenic
1076341288 10:129747566-129747588 ATGGTATAATTTGGGAAAATAGG - Intronic
1077452511 11:2657547-2657569 ATGCTAACATTAGGGGAAGCTGG - Intronic
1077936144 11:6788800-6788822 CAGTTATAATGAGGGAAAACAGG - Intergenic
1078260195 11:9698995-9699017 ATGCTTTAATTCGGAAAAAAAGG + Intronic
1078949685 11:16116581-16116603 ATGTTATCATTTGGGGAAACTGG - Intronic
1079191439 11:18280758-18280780 ATGCTATGCTCAGTGAAAACAGG + Intronic
1079772773 11:24483988-24484010 AAGCTATAATTAATGTAAACAGG - Intergenic
1080652859 11:34236496-34236518 ATGCTGCTGTTAGGGAAAACTGG - Intronic
1080785550 11:35471963-35471985 ATGCCAGCATTAGGGAACACTGG + Intronic
1081443994 11:43111896-43111918 ATGTTATCATTGGGGGAAACTGG + Intergenic
1082110111 11:48264791-48264813 ATGATTTAGTTAGGGAAAATAGG + Intergenic
1083009278 11:59380345-59380367 TAGCTATAATTAGATAAAACAGG - Intergenic
1085244653 11:75090406-75090428 CTGCAATGATTAGGGAAACCTGG + Intergenic
1085665545 11:78412630-78412652 ATGTTACCATTAAGGAAAACTGG + Intronic
1086031713 11:82366746-82366768 ATGTTATTAATAGGGCAAACTGG + Intergenic
1086375115 11:86192286-86192308 ATGTTAGAATTAGGCAATACTGG + Intergenic
1086545295 11:87960841-87960863 ATGCTACAAATGGGCAAAACAGG - Intergenic
1086608190 11:88722788-88722810 ATGTTAATATTAGGGGAAACTGG - Intronic
1086636371 11:89092058-89092080 ATGCTTAAATTAGATAAAACAGG + Intergenic
1087186329 11:95201271-95201293 CTGCTATTATTAGTGGAAACTGG + Intronic
1087744481 11:101927415-101927437 ATGTTATCATTGGGGGAAACTGG - Intronic
1087816888 11:102668390-102668412 ATGTAATCATTGGGGAAAACTGG - Intergenic
1089441363 11:118520272-118520294 ATACTATCATTAAAGAAAACAGG - Intronic
1089873679 11:121699334-121699356 ATCCTACCATTAGGAAAAACTGG - Intergenic
1090724014 11:129505787-129505809 ATGTTACCATTAGGGAAAACTGG - Intergenic
1092216986 12:6690108-6690130 GTGCTATATTTAAGTAAAACAGG - Intergenic
1092376595 12:7960706-7960728 ATGCATAAATTAGGGAAGACGGG - Intergenic
1092495010 12:8984972-8984994 ATGCTAACATTAGGGGAAATGGG - Intronic
1092909768 12:13136450-13136472 ATGCTAAAATTGGGAGAAACTGG + Intronic
1094286327 12:28798548-28798570 ATGCTTTCATTAGGAAAACCAGG + Intergenic
1096438241 12:51614536-51614558 ATGCTAACATTAGGGGAAGCTGG - Intronic
1096504398 12:52083432-52083454 CTGCTAGAAATAGGTAAAACTGG - Intergenic
1097474662 12:60038414-60038436 ATGCTATAGCAAGGGAGAACAGG + Intergenic
1097825007 12:64166636-64166658 AAGCTATCATTAGAGCAAACAGG + Intergenic
1097969481 12:65617250-65617272 ATGCTAGAAATAGGGAAACAGGG - Intergenic
1098556816 12:71828182-71828204 ATGCTATCACTGGGAAAAACTGG - Intergenic
1099457743 12:82884685-82884707 ATGCTAATAATAGGGGAAACTGG - Intronic
1099553130 12:84073164-84073186 AAGCTCTAATTAGGGAAGAAGGG - Intergenic
1099687558 12:85908990-85909012 AAGCTATCATCAGGGAGAACAGG + Intergenic
1099788040 12:87292647-87292669 ATGCTATAATTAATGCAAACAGG + Intergenic
1100078105 12:90812951-90812973 ATGTTAAAAATAGGAAAAACAGG + Intergenic
1100307948 12:93368456-93368478 TTGCTATCTTTTGGGAAAACAGG - Intergenic
1101167079 12:102049448-102049470 ATGCTATGGTTTGGGATAACAGG + Intronic
1101428218 12:104605224-104605246 TGGCTATAATCTGGGAAAACTGG + Intronic
1101808716 12:108089718-108089740 TTTATATAATTATGGAAAACAGG - Intergenic
1102651107 12:114443209-114443231 ATTCTCTAATTTGGGAAACCTGG + Intergenic
1103960823 12:124608199-124608221 ATGCTAACAGTAGGGTAAACTGG - Intergenic
1105930594 13:25048344-25048366 ATACTATAATTAGGACAAAGGGG - Intergenic
1106442178 13:29785253-29785275 ATGTTACCATTAGGGAAAACTGG + Intronic
1107782011 13:43913526-43913548 ATGCAGGAAATAGGGAAAACTGG + Intergenic
1109064874 13:57674163-57674185 TTGCTAAAATTAGGGAATGCTGG + Intronic
1109399594 13:61808118-61808140 AAGCTATAATTAGAGTGAACAGG + Intergenic
1109440202 13:62360524-62360546 ATGCTATAATAAGAGCAAAAAGG + Intergenic
1109724713 13:66324889-66324911 ATGCTAAAATCAAGTAAAACTGG + Intronic
1110116073 13:71818239-71818261 ATGCTATAATTAGGGAAAACAGG + Intronic
1110195441 13:72782770-72782792 ATGTTTTAAATAGGGAAAACGGG - Intronic
1110310029 13:74038176-74038198 ATGCTACCAGTGGGGAAAACTGG + Intronic
1110870505 13:80447255-80447277 ATATTATGATTAGGGGAAACTGG + Intergenic
1111100672 13:83581170-83581192 ATGTTAGAACTAGGGAAAACTGG - Intergenic
1112905210 13:104409526-104409548 ATGCTATCATTTGGAGAAACTGG + Intergenic
1113154167 13:107298827-107298849 TTGTTATCATTAGGGAAAGCTGG - Intronic
1113362567 13:109644941-109644963 ATAATATAATTAAGGAAAAGGGG + Intergenic
1114739366 14:25079418-25079440 ATACTCTAATTAAAGAAAACAGG - Intergenic
1115076418 14:29397694-29397716 ATGTTATCATTGGAGAAAACTGG - Intergenic
1115741282 14:36391579-36391601 ATGCTATAACAAAGGAAAATTGG - Intergenic
1116611084 14:47072900-47072922 ATGTTATAATTAGGATTAACAGG - Intronic
1116906539 14:50409062-50409084 ATGTTATTACTAGGGGAAACTGG - Intronic
1118114532 14:62760423-62760445 GTGCTATCATTAGGGGAAATCGG + Intronic
1118407717 14:65443019-65443041 ATGTTAATAATAGGGAAAACCGG + Intronic
1118929609 14:70229230-70229252 AAACTATCATTAGAGAAAACAGG + Intergenic
1119664597 14:76475943-76475965 ATGTTACCATTAGGGGAAACTGG - Intronic
1120368279 14:83598694-83598716 ATGATAATAATAGGGAAAACTGG - Intergenic
1121677231 14:95763450-95763472 ATGCTAAGAATAGGAAAAACTGG + Intergenic
1122731538 14:103802901-103802923 TTGCTAAAATTAGGAAAGACAGG - Intronic
1124878848 15:33622752-33622774 ATGTTTTAATTATGGAAAACTGG + Intronic
1124918677 15:34002066-34002088 ATGTTATCATTGGGGTAAACTGG - Intronic
1125547532 15:40517524-40517546 AATCTATAATTAGGGACAATTGG + Intergenic
1125846239 15:42857129-42857151 ATGTTAATAATAGGGAAAACTGG + Intronic
1127027906 15:54828459-54828481 ATGATAAACTTAGGGGAAACTGG + Intergenic
1128068806 15:64780806-64780828 ATCCTATAACTAGGGATAGCAGG - Intergenic
1128438082 15:67675568-67675590 ATGTTACCATTAGGGGAAACTGG + Intronic
1130217771 15:81988343-81988365 ATGTTTTAATTAGGGAAATTAGG + Intergenic
1132029396 15:98427851-98427873 ATGAAGTAATTAGGGAAATCTGG + Intergenic
1132077736 15:98836557-98836579 ATGCTAACGTTAGGGAAAACTGG - Intronic
1133636794 16:7674223-7674245 ATGTAATAATTAGGGAAAAAGGG - Intronic
1134345375 16:13386219-13386241 ATGTTATCATTAGGAGAAACTGG + Intergenic
1134563357 16:15229813-15229835 ATGCTAACATTAGGGGGAACTGG + Intergenic
1134743688 16:16571059-16571081 ATGCTAACATTAGGGGGAACTGG - Intergenic
1134923883 16:18141442-18141464 ATGCTAACATTAGGGGGAACTGG + Intergenic
1135058021 16:19246871-19246893 ATGCTTTAATGTGGGAAGACAGG + Intronic
1135132255 16:19862651-19862673 ATGCTAGGATTAGGGATTACAGG - Intronic
1137538866 16:49348411-49348433 ATGCTTTTATTAGGTAAATCTGG - Intergenic
1137949418 16:52768999-52769021 ATGCTAACATTAGGAAGAACAGG + Intergenic
1138258270 16:55589791-55589813 ATTCTATAATTATTGAAAAGGGG + Intergenic
1138401057 16:56744555-56744577 ATACTATATTTGGGAAAAACTGG - Intronic
1138697948 16:58833251-58833273 ATAGTATAATTGGGGGAAACAGG - Intergenic
1139457513 16:67093587-67093609 ATGATATACTGAGAGAAAACAGG + Intronic
1139892790 16:70264680-70264702 ATGTTACAATTAGGGGAAACTGG + Intronic
1140975144 16:80052875-80052897 ATGTTAAAAATAGGGGAAACTGG - Intergenic
1144026235 17:11278516-11278538 ATGTTCTAGTTAGGAAAAACTGG - Intronic
1146291440 17:31610448-31610470 ATGCTCTAATTAGGGGAGAAAGG + Intergenic
1147908695 17:43841302-43841324 ATGCTAACATTAGAGAAAACAGG - Intergenic
1148407701 17:47432901-47432923 ATGCTAACATTAGGGGAAGCTGG - Intronic
1148502877 17:48105072-48105094 ATGCCAGAATTAGGGAAAATAGG - Intronic
1149118183 17:53125395-53125417 ATGTTAATATTTGGGAAAACTGG + Intergenic
1149738373 17:59018161-59018183 ATGAATTAATTAGGGAAAAAAGG + Intronic
1150346674 17:64410076-64410098 ATGTTACCATTAGGGGAAACTGG + Intronic
1151810492 17:76437767-76437789 ATGTGAACATTAGGGAAAACTGG + Intronic
1153473939 18:5476595-5476617 ATGGAATAAATAGGGTAAACTGG - Intronic
1155600278 18:27538023-27538045 ATGTTATAAATAGAGAAATCTGG + Intergenic
1155622082 18:27790812-27790834 ATGATATAATTAGAAAAATCAGG - Intergenic
1156118414 18:33815155-33815177 ATACTAACATTAGAGAAAACTGG - Intergenic
1157951040 18:52037324-52037346 AGGCAATAATTATGGAAAACAGG + Intergenic
1158101611 18:53835524-53835546 ATGCTAAAATTAGTTAAGACTGG + Intergenic
1158128842 18:54130615-54130637 CAGCTATAATTCTGGAAAACTGG + Intergenic
1159755095 18:72354602-72354624 ATGTTATATTTAGGCAGAACTGG - Intergenic
1161141113 19:2648435-2648457 ATGCTAACATAAGGGAAAACTGG + Intronic
1164863691 19:31584874-31584896 ATGCTAACATTAGAAAAAACAGG - Intergenic
1166015614 19:39977285-39977307 ATAGTATAATTAGGAAAACCAGG + Intronic
1167866604 19:52334110-52334132 ATGTTAATAATAGGGAAAACGGG + Intergenic
926076229 2:9945351-9945373 ATGCTACAGTGAGGGAAAATGGG + Intergenic
927082572 2:19644982-19645004 ATGTTAACATTAGGGGAAACTGG + Intergenic
927690644 2:25205661-25205683 ATGTTACCATTGGGGAAAACTGG - Intergenic
927736690 2:25530056-25530078 GTGATATAATTATGAAAAACAGG + Intronic
927801937 2:26108707-26108729 ATGTTATCATTAGGAAAAGCTGG + Intronic
928433287 2:31237704-31237726 ATGCTATAAGTAAGAAAAACTGG - Intronic
928555078 2:32415173-32415195 ATGCTATAAAGAAGCAAAACCGG - Exonic
930060554 2:47284685-47284707 CTCCTATAATTAGGGAAAATGGG + Intergenic
931050139 2:58404122-58404144 ATGCTAATAATAGGGGAAACTGG + Intergenic
931977794 2:67662407-67662429 ATGTTAACATTAGGGGAAACTGG - Intergenic
932214363 2:69957340-69957362 ATGCTAATATTTGGGGAAACTGG + Intergenic
932987318 2:76741530-76741552 ATGCTACAATAAGGAAGAACTGG - Intergenic
933884678 2:86707121-86707143 ATGTTATCATTGGGGGAAACTGG - Intronic
933982043 2:87558478-87558500 ATGTTATCTTTAGGGGAAACTGG - Intergenic
934509975 2:94929976-94929998 ATTCTATAATTAGGTAGGACTGG - Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
935634637 2:105240769-105240791 ATGTTACCATTAGGGAAAACTGG + Intergenic
936311794 2:111392334-111392356 ATGTTATCTTTAGGGGAAACTGG + Intergenic
939244104 2:139600523-139600545 ATTCTATAATTAAGGATGACTGG - Intergenic
939318922 2:140589985-140590007 ATGTAATCATTAGGGAAAACTGG + Intronic
939581289 2:143949932-143949954 ATACAATTATTAGGAAAAACTGG - Intronic
940969578 2:159881027-159881049 ATATTATCATTAGGTAAAACAGG + Intronic
941036403 2:160573744-160573766 ATGTTACCATTGGGGAAAACTGG + Intergenic
941208626 2:162607506-162607528 ATGTTATAATTAGGAAAATAGGG + Intronic
941407814 2:165113502-165113524 ATACAATTATTAGGGAGAACTGG + Intronic
942605923 2:177690911-177690933 ATCTGATAAATAGGGAAAACTGG - Intronic
943252839 2:185551275-185551297 TTGCAAGAATTAGGGAAACCAGG + Intergenic
943450952 2:188041325-188041347 ATGTTACTATTGGGGAAAACTGG + Intergenic
944811558 2:203331658-203331680 ATGCTATAATAAGGCTAAATTGG - Intronic
944858886 2:203795424-203795446 CTGCAATAAGCAGGGAAAACTGG + Intergenic
945789533 2:214287763-214287785 GTGCTAAAATTAATGAAAACTGG - Intronic
946138620 2:217668929-217668951 ATGTTAAAATTAGGGAAATCTGG + Intronic
946426440 2:219600438-219600460 ATGTAACCATTAGGGAAAACTGG + Intronic
947880056 2:233500352-233500374 TTTTTATATTTAGGGAAAACGGG - Intronic
948352385 2:237351423-237351445 ATGCATTAATTTGTGAAAACTGG - Intronic
1168781339 20:493548-493570 ATGTTACTATTAGGGGAAACTGG - Intronic
1169279536 20:4255275-4255297 ATGGTCTAATTAAGGAAATCAGG - Intergenic
1170285520 20:14704260-14704282 ACGCTATATTCAGGGACAACAGG - Intronic
1170531578 20:17298121-17298143 ATTTTATAATTAGAGAAAATGGG - Intronic
1170794447 20:19534155-19534177 ATTCTATATTTACAGAAAACTGG - Intronic
1171147682 20:22800136-22800158 ATGGTATTATCAGGGAAAAGGGG - Intergenic
1172052679 20:32130910-32130932 ATGTTAGCATTAGGGGAAACTGG + Intronic
1172918013 20:38458493-38458515 ATGCTAATATTAGGGGAAGCTGG - Intergenic
1173045857 20:39511100-39511122 ATGTTATCATTGGGGGAAACTGG - Intergenic
1173381937 20:42553145-42553167 ATGGTATAATAATGGAAAATTGG + Intronic
1173887759 20:46476491-46476513 ATGTTACCATTAGGCAAAACTGG + Intergenic
1174298610 20:49566932-49566954 ATGTTAACAATAGGGAAAACGGG + Intronic
1174758989 20:53187821-53187843 GTGCTATCATGAGGGAAAATGGG + Intronic
1174976001 20:55335039-55335061 ATGCTATCATTTGGGGAAGCTGG - Intergenic
1175203177 20:57291870-57291892 ATGCTAACATTAGGGGAAGCCGG - Intergenic
1175405653 20:58724509-58724531 ATGTCAAAATTAGGGAAAACCGG + Intergenic
1175646818 20:60681520-60681542 ATATTATAATTGGGGGAAACTGG - Intergenic
1176360320 21:5989800-5989822 ATGCTAACATTAGGGGAAGCTGG - Intergenic
1176605053 21:8823226-8823248 ATGATATAATTTGGTAGAACTGG + Intergenic
1176658093 21:9606221-9606243 ACGCTAAAATTAGGGGAGACTGG + Intergenic
1177280803 21:18980780-18980802 ATGCTAAAAATGGGAAAAACCGG + Intergenic
1177469239 21:21535763-21535785 AGGCTATATTTTGGGAAAAAAGG + Intronic
1177641224 21:23846651-23846673 TTGCTATGCTTAGGAAAAACTGG - Intergenic
1177808327 21:25897918-25897940 ATGCTATAATTTTTGAAAATGGG + Intronic
1177824177 21:26064317-26064339 ATGTTAACAATAGGGAAAACTGG + Intronic
1178240137 21:30889885-30889907 TTGATATAAGTAGGGAAAAAAGG - Intergenic
1178735918 21:35150761-35150783 ATGTTATCATTAGGGGAAGCTGG + Intronic
1179763198 21:43548750-43548772 ATGCTAACATTAGGGGAAGCTGG + Intronic
1180347345 22:11714831-11714853 ATGATATAATTTGGTAGAACTGG + Intergenic
1180355105 22:11832936-11832958 ATGATATAATTGGGTAGAACTGG + Intergenic
1180383146 22:12159395-12159417 ATGATATAATTGGGTAGAACTGG - Intergenic
1180947186 22:19702648-19702670 ATGGCATCATTGGGGAAAACTGG + Intergenic
1181611223 22:24013575-24013597 ATGTTAACATTAGGGAAAGCAGG - Intronic
1181763549 22:25075024-25075046 ATGCTAACATTAGGGGAACCGGG - Intronic
1182912539 22:33997507-33997529 ATTCTATCATGACGGAAAACAGG - Intergenic
1183507274 22:38216048-38216070 ATCTTATATTTAGGGAAAGCCGG + Exonic
1183670869 22:39271879-39271901 ATGTTAACATTAGGGGAAACTGG - Intergenic
1183838597 22:40478374-40478396 ATGCTAACATTAGGGGCAACTGG + Intronic
1184624330 22:45711600-45711622 ATGTTACCATTGGGGAAAACTGG + Intronic
1184811975 22:46842021-46842043 ATGTTATTATTAGGGATACCAGG - Intronic
1185023526 22:48394650-48394672 ATACTTTAAATATGGAAAACAGG - Intergenic
949251848 3:1994683-1994705 ATGTTAATAATAGGGAAAACTGG + Intergenic
949688373 3:6604765-6604787 ATATTACTATTAGGGAAAACTGG - Intergenic
950473025 3:13198128-13198150 TTGTTAGAATTAGAGAAAACAGG - Intergenic
951254953 3:20438028-20438050 TTGATATATTTAGGGAATACAGG + Intergenic
952286585 3:31975447-31975469 ATGCTTTAATTTGGGATAAGTGG + Intronic
952628084 3:35430885-35430907 ATGTTAAAAATAGGGAAAATTGG - Intergenic
952804537 3:37335690-37335712 ATGCAATGATTTGGGAAAATTGG + Intronic
953282001 3:41567908-41567930 ATGTTAACATGAGGGAAAACTGG - Intronic
953342203 3:42144195-42144217 AAGCTACAATTAGGGAAATGAGG - Intronic
953431783 3:42846066-42846088 ATGTTATAATGAGGAAAATCAGG - Intronic
955024151 3:55151148-55151170 ATGTTATCACTGGGGAAAACTGG - Intergenic
955151695 3:56374009-56374031 ATGATATTATAAAGGAAAACTGG - Intronic
955685374 3:61543975-61543997 AGGCAATAATTAAGGAAACCAGG + Intergenic
955846271 3:63166422-63166444 ATGTTACCATTAGGGAAAACCGG - Intergenic
956974915 3:74568185-74568207 ATGATTTAATGAAGGAAAACAGG + Intergenic
957403923 3:79752714-79752736 AGGCTATAATTATGGAAAATAGG + Intronic
957600435 3:82327164-82327186 ATGCAATAATTAGGGAGGAGAGG - Intergenic
957903327 3:86526146-86526168 TTGCTATAAGGAGGGGAAACAGG + Intergenic
957968296 3:87349837-87349859 AAGCTATAATTTGGGAAACATGG + Intergenic
958158820 3:89790169-89790191 ATGGTATAATTATGAAGAACAGG + Intergenic
958858487 3:99416588-99416610 ATGTTAACATTGGGGAAAACTGG + Intergenic
959088350 3:101875615-101875637 ATGAAATAATTTGGGACAACTGG - Intergenic
959241208 3:103797135-103797157 ATGTTACAATCAGGGGAAACTGG - Intergenic
959959484 3:112281237-112281259 GTGCCAGAATTAGTGAAAACAGG - Intronic
960102052 3:113754221-113754243 TTTCTGTAATTAGGAAAAACAGG + Intronic
960189019 3:114680794-114680816 ATGCTAGAGTCAGGGAAAACTGG + Intronic
960517447 3:118617901-118617923 ATACTAACATTAGGGAAAACTGG - Intergenic
961173617 3:124816428-124816450 ATCCTAAACTTAGGTAAAACAGG - Intronic
961421666 3:126810676-126810698 ATGTTAACATTAGGGGAAACTGG + Intronic
963475988 3:145805280-145805302 ATTTTATAATTAGGGAAATTTGG + Intergenic
965091773 3:164172520-164172542 ATAATATAATTATGGAAATCAGG + Intergenic
965662486 3:171056322-171056344 ATTCTGAAACTAGGGAAAACAGG + Intergenic
966231212 3:177654334-177654356 GTGCTAAAAATAGGAAAAACTGG - Intergenic
967723881 3:192843756-192843778 ATTTTATAATTTGGGTAAACAGG - Intronic
969164171 4:5291651-5291673 AAGCTATAGTCAGGGAAAATAGG - Intronic
970419197 4:15889503-15889525 ATGCTATGCTTAGAGAAAAAAGG - Intergenic
973373062 4:49267712-49267734 ATGATATAATTGGGTAGAACTGG - Intergenic
973387939 4:49527369-49527391 ATGATATAATTGGGTAGAACTGG + Intergenic
974252130 4:59399616-59399638 AATCCATAATTAGGGAAAAACGG + Intergenic
975815291 4:78210682-78210704 ATGATACAATTATGGAAAATAGG + Intronic
975875745 4:78834986-78835008 ATGCTAGAATTCAGGAAAATGGG - Intronic
976616305 4:87081070-87081092 ATGCTAACATTTGGGAAATCTGG + Intronic
976848451 4:89516977-89516999 ATGTTAGCATTAGGGGAAACTGG - Intergenic
976910537 4:90299818-90299840 ATGATATAATTAGGTAAGACTGG + Intronic
977407853 4:96622623-96622645 ATGTTACCATTAGGGAAATCAGG - Intergenic
980574616 4:134668841-134668863 GTGTTATAATCAGTGAAAACTGG - Intergenic
980574623 4:134668919-134668941 GTGTTATAATCAGTGAAAACTGG - Intergenic
981543534 4:145871201-145871223 ATGCTAACATTAGGGAATTCTGG - Intronic
981552423 4:145955513-145955535 ATTCTTTCATTAGGGAAAAAGGG - Intergenic
983176563 4:164595635-164595657 ATGCCAAACTTAGGGAGAACTGG + Intergenic
983584961 4:169344603-169344625 ATGTTACCATTGGGGAAAACTGG - Intergenic
985417316 4:189749852-189749874 ACGCTACAATTAGGGGAGACTGG - Intergenic
986080498 5:4387146-4387168 ATGTTTTATTTAGGAAAAACAGG + Intergenic
986621584 5:9681258-9681280 ATGATAAAAATAGGGAAAAATGG + Intronic
989349335 5:40468170-40468192 AGGCTTTAACTAGGGAAAATAGG + Intergenic
989961358 5:50419600-50419622 TTGCTACAATTAGTGAAGACTGG + Intronic
990319215 5:54613142-54613164 ATGCCATAATTGGGAAATACTGG + Intergenic
991011330 5:61885854-61885876 ATGTTAATATTAGGGAAAGCTGG + Intergenic
991071493 5:62487239-62487261 ATGATATAATAAGCAAAAACAGG - Intronic
991083468 5:62625981-62626003 ATGTTAACATTAGGAAAAACTGG - Intronic
991564330 5:67989205-67989227 ATGCTAATGATAGGGAAAACGGG + Intergenic
991910866 5:71559447-71559469 TAGCTATACTAAGGGAAAACAGG + Intronic
992989152 5:82266091-82266113 ATACTATCATTTGGGAAAGCTGG - Intronic
993249485 5:85500090-85500112 ATGCTATTACTGGGGAAAATTGG + Intergenic
993849565 5:92989949-92989971 AGGCTAATATTAGGGGAAACTGG + Intergenic
994443268 5:99837317-99837339 CTGAAATAATTAGGGGAAACAGG - Intergenic
994838454 5:104888278-104888300 AAGCTTTAGTTAGGGAAAAAAGG + Intergenic
995202193 5:109438648-109438670 ATGTTAATAATAGGGAAAACTGG + Intergenic
995904661 5:117109143-117109165 ACGTTAAAATTTGGGAAAACTGG + Intergenic
996078183 5:119222937-119222959 ATGCCTTAATTAGGGAAGCCAGG - Intronic
996409847 5:123145762-123145784 ATGCTTTATTAAGGGAAAAGTGG - Intronic
996425592 5:123310572-123310594 ATGCTATTATTAGGTGAGACTGG - Intergenic
996869493 5:128172279-128172301 ATGTTATCATTGGGGGAAACTGG - Intronic
996890174 5:128409579-128409601 AAGCTGCAATTAGGGATAACTGG + Intronic
996915529 5:128707642-128707664 ATGTTAAAATTATGGAAATCTGG - Intronic
998459658 5:142300439-142300461 ATATTAAAATTAGGGAAAGCTGG - Intergenic
998993034 5:147839599-147839621 ATGTTAAGAATAGGGAAAACTGG - Intergenic
999099283 5:149009229-149009251 TTCCTATAATTGGGGAAACCTGG + Intronic
1000513697 5:162214293-162214315 ATATTATAATTAGGTAAATCTGG - Intergenic
1000524512 5:162339882-162339904 ATGTTAATAATAGGGAAAACTGG - Intergenic
1001302853 5:170549529-170549551 ATAGTATAATTAAGGAAATCTGG + Intronic
1002912789 6:1503481-1503503 ATGCTAACATTAGGGGAAGCTGG + Intergenic
1003045629 6:2730407-2730429 ATGCTGCAATGAAGGAAAACTGG - Intronic
1006241332 6:32681818-32681840 ATGTGACAATTGGGGAAAACTGG + Intergenic
1006249480 6:32769254-32769276 ATGTTACAATTGGGGAAAACTGG + Intergenic
1007145719 6:39628124-39628146 ATGTTACAATTGGGAAAAACTGG - Intronic
1007306820 6:40913374-40913396 ATGCTATAATTTGTGCAAAAGGG + Intergenic
1007923705 6:45633984-45634006 ATGCTATAATAAGGCTAATCTGG + Intronic
1008022125 6:46590828-46590850 ATACAATAAAAAGGGAAAACAGG - Intronic
1008044357 6:46836512-46836534 ATGCTAACATTAGGGAAAGCTGG - Intronic
1009651966 6:66488789-66488811 ATGTGATAATTAGGAAAAAGTGG + Intergenic
1009676324 6:66827085-66827107 TTGATATAAATAGGGAAAAGAGG - Intergenic
1009927648 6:70139407-70139429 AAGCTCTATTTAAGGAAAACAGG - Intronic
1012419000 6:99041640-99041662 TTTCTATATTTATGGAAAACTGG - Intergenic
1012471677 6:99579594-99579616 ATGTTAATATTAGGGGAAACTGG + Intergenic
1012939905 6:105404528-105404550 ATTTTATAGTTAAGGAAAACGGG + Intergenic
1014602164 6:123426952-123426974 ATGCAAAAAATAGGGAAAAATGG - Intronic
1014776328 6:125514164-125514186 ATGTTATTATTGGGGGAAACTGG - Intergenic
1016048091 6:139501341-139501363 AAGCTATAACTAGGGAATAGGGG - Intergenic
1017145743 6:151233012-151233034 ATGTTACTATTGGGGAAAACTGG - Intergenic
1018943274 6:168325461-168325483 ATGAAATAAATAGGGAAAAAAGG - Intergenic
1020729947 7:11868260-11868282 ATGTTAATATTAGGGAAAAATGG - Intergenic
1020966077 7:14870427-14870449 TTTCCATAATTAGAGAAAACAGG - Intronic
1021873030 7:25022275-25022297 ATACTATATTTAGGGAATACGGG - Intergenic
1021955396 7:25819353-25819375 ATGCAAAAATTATGTAAAACTGG - Intergenic
1022039846 7:26570370-26570392 ATGCTATCATTTGGGGAAACAGG + Intergenic
1022512199 7:30945778-30945800 ATGTTAAAAATAGGGGAAACTGG - Intronic
1023654813 7:42408703-42408725 GTGCTATAATTAGGGATGTCAGG + Intergenic
1024988482 7:55216166-55216188 ATGTTATATTTAGGGATAATTGG - Intronic
1027715064 7:81659365-81659387 ATGCTATAATGTTGGAGAACAGG + Intergenic
1028121114 7:87058071-87058093 ATGTTGTAATTGGGGAAATCAGG - Intronic
1030121652 7:106115865-106115887 ATGTTAACATTAGGGGAAACTGG - Intergenic
1030547911 7:110920851-110920873 ATGTTAACATTAGGGAAAGCTGG - Intronic
1031510172 7:122639408-122639430 GTGCTATCATTAGGGAAAACTGG - Intronic
1032563678 7:132918218-132918240 ATGATATAATTAGGGAGAGAAGG + Intronic
1035785542 8:2257273-2257295 ACACTATGCTTAGGGAAAACAGG - Intergenic
1035807266 8:2464443-2464465 ACACTATGCTTAGGGAAAACAGG + Intergenic
1035953400 8:4049774-4049796 ATGCTAACAGTAAGGAAAACGGG - Intronic
1036543746 8:9746179-9746201 ATGCTATAATTTGGTGCAACTGG - Intronic
1039202753 8:35114618-35114640 CTGTTAAAAATAGGGAAAACTGG - Intergenic
1039749745 8:40466476-40466498 ATGCTAACATTAGGGGAAGCTGG + Intergenic
1039915353 8:41856431-41856453 ATATTATAATTAGGAAAACCTGG + Intronic
1041557881 8:59179281-59179303 ATGCTACCATTGGAGAAAACTGG - Intergenic
1042290421 8:67165332-67165354 ATGTTAACAATAGGGAAAACTGG - Intronic
1042639259 8:70915218-70915240 ATGCTATACATAGGGGCAACTGG + Intergenic
1043622950 8:82219570-82219592 ATGGTAGAATTAGGGGAAAAAGG + Intergenic
1043834050 8:85026003-85026025 CTGCTAAAATCAGAGAAAACAGG - Intergenic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1044310799 8:90689840-90689862 ATGTTAACAATAGGGAAAACTGG - Intronic
1045195008 8:99921887-99921909 ATCCTAGAACTAAGGAAAACTGG - Intergenic
1045410636 8:101913976-101913998 ATGTTAATATTTGGGAAAACTGG - Intronic
1046490624 8:114948368-114948390 TTGCTATAATTAGAAATAACGGG + Intergenic
1047075822 8:121401499-121401521 ATGTTAATATTAGGGAAAATTGG - Intergenic
1047109437 8:121772698-121772720 ATGCTATTATTATGAATAACAGG + Intergenic
1047920094 8:129626511-129626533 CTGATATTATAAGGGAAAACTGG - Intergenic
1048482649 8:134814112-134814134 CTACTATAATTAGGGAAAAATGG - Intergenic
1050513440 9:6417432-6417454 AAGCTCTAAGTAGGGAAAAAAGG - Intronic
1051807260 9:21008815-21008837 ATGTTATCATTAGGGTAAGCTGG + Intronic
1052001393 9:23286021-23286043 ATGCTACAATTAGTGAACATGGG + Intergenic
1052244434 9:26317216-26317238 ATACTATAAGTAGGCAAAAGGGG - Intergenic
1052407495 9:28080757-28080779 ATTCTATAATTAGTGAAGAGAGG + Intronic
1052564115 9:30124823-30124845 ATGTTAGTAATAGGGAAAACAGG + Intergenic
1056057031 9:82835733-82835755 ATACTACAATTGGGGGAAACTGG + Intergenic
1056067478 9:82951935-82951957 ATGCTATAATTAAGGAAATGTGG - Intergenic
1056175261 9:84028616-84028638 ATGCTATCATTTTGGAAAACTGG - Intergenic
1057107674 9:92435424-92435446 ATGTTATCATTAGGGGAAACTGG - Intronic
1057811263 9:98258580-98258602 ATGTTAACATTAGGGGAAACTGG - Intergenic
1058252069 9:102711676-102711698 CAGCTATAGTTAGGGAAAAGAGG - Intergenic
1058255518 9:102757431-102757453 ATGCTAAACATAGAGAAAACTGG - Intergenic
1059034740 9:110741954-110741976 ATGGTATAATTAGAGACATCAGG + Intronic
1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG + Intronic
1060319634 9:122544947-122544969 ATGCTTGAATTAAGGAAAAAAGG - Intergenic
1060751414 9:126171972-126171994 ATGCTAATAATAGGGGAAACTGG - Intergenic
1060792128 9:126493174-126493196 ATAAAATAATAAGGGAAAACAGG - Intronic
1203696772 Un_GL000214v1:105717-105739 ATGATATAATTGGGTAGAACTGG - Intergenic
1203552442 Un_KI270743v1:175312-175334 ATGATATAATTGGGTAGAACTGG + Intergenic
1203635821 Un_KI270750v1:109796-109818 ACGCTAAAATTAGGGGAGACTGG + Intergenic
1185994043 X:4924232-4924254 TTTCTATAAGTTGGGAAAACTGG - Intergenic
1186157735 X:6743051-6743073 ATGCTTTCAGTAGGGGAAACTGG + Intergenic
1186815381 X:13232355-13232377 ATGCTTCAATTAGGGAAAGGGGG - Intergenic
1188063266 X:25626968-25626990 ATGGTAGCATTAGGGAAAACTGG - Intergenic
1188459446 X:30406829-30406851 TTGTTATGATTATGGAAAACTGG - Intergenic
1188512592 X:30952625-30952647 ATGTTAAAATTAGGGTAATCTGG + Intronic
1188562595 X:31486380-31486402 ATGCTGTAAATTGGGAAAAATGG + Intronic
1189823130 X:44889925-44889947 ATGCTACAGTTGGGGGAAACTGG - Intronic
1191112694 X:56819877-56819899 ATGTTAGAATGTGGGAAAACAGG + Intergenic
1192384488 X:70652435-70652457 ATACTAGAATTATGAAAAACTGG + Intronic
1192835732 X:74797390-74797412 ATGATAACATTAGGGGAAACTGG + Intronic
1192960279 X:76122857-76122879 ATGTAATCATTAGGGAAATCTGG + Intergenic
1194936188 X:99951803-99951825 ATGCTATAATGAGGAATGACAGG + Intergenic
1195911446 X:109892014-109892036 ATGTTACCATTGGGGAAAACTGG - Intergenic
1197686835 X:129449085-129449107 ATGTTACTATTGGGGAAAACTGG + Intronic
1198589986 X:138168025-138168047 ATGATAGCATTGGGGAAAACTGG - Intergenic
1198789177 X:140324171-140324193 ATGCTATCATTGGAAAAAACTGG + Intergenic
1198794573 X:140381816-140381838 ATTCTATAATTTGGAGAAACAGG + Intergenic
1198871792 X:141183488-141183510 ATGCTGCATGTAGGGAAAACTGG + Intergenic
1199689723 X:150299456-150299478 ATGTTACCATTAGGGGAAACTGG + Intergenic
1199823406 X:151473482-151473504 ATGATATAATTGGTGAATACAGG + Intergenic
1201997570 Y:20110728-20110750 ATGCTAGAATTAGGAATATCTGG - Intergenic