ID: 1110119597

View in Genome Browser
Species Human (GRCh38)
Location 13:71865762-71865784
Sequence GCGGCTGGCGAGCCCCGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110119594_1110119597 -1 Left 1110119594 13:71865740-71865762 CCAACTTCTCAGGGGGTCGGGCG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 161
1110119584_1110119597 30 Left 1110119584 13:71865709-71865731 CCGAAGAGCGAGGTCTGGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 240
Right 1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110119597 Original CRISPR GCGGCTGGCGAGCCCCGAGC AGG Intronic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900417108 1:2540335-2540357 GCAGCTGGCGTGCCCTGCGCAGG - Intergenic
901441663 1:9281923-9281945 GCAGCAGTCCAGCCCCGAGCTGG + Intergenic
901448406 1:9321930-9321952 GTGACTGGAGAGCCCAGAGCAGG - Intronic
904697091 1:32336686-32336708 GCGGGTGCCGAGCCCAGCGCAGG - Intergenic
905862568 1:41361282-41361304 GCGGCGGGGTCGCCCCGAGCTGG + Intergenic
906306773 1:44724644-44724666 GCGGCTGGCCAGCCTCACGCTGG + Exonic
907513812 1:54980838-54980860 GCGGCTGGTGAGCCCTGGGAGGG + Exonic
910163424 1:84298515-84298537 GCGGCCGCCGAGCTCCGCGCGGG + Exonic
910449179 1:87329253-87329275 GCGGGTGGAGAGCCGCGGGCCGG + Intronic
915321330 1:155057953-155057975 GGGGATGGCGAGCCCTGCGCTGG + Exonic
915367361 1:155323637-155323659 CTGCCTGGCCAGCCCCGAGCTGG + Intronic
917141811 1:171842137-171842159 GGGGCTGGCGCGCACCGAGGGGG - Intronic
923055977 1:230426145-230426167 GCGGGAGGCGAGCCGCGCGCGGG + Intergenic
1064709663 10:18110517-18110539 GAGGCTGAGGAGCCCCCAGCAGG + Intergenic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1067274060 10:44819053-44819075 GCTGCTGGCGAGGCTCCAGCTGG - Intergenic
1072021798 10:91410168-91410190 GCGACGCGCGAGCCCCGGGCGGG + Intergenic
1072783989 10:98268237-98268259 GCGGCCCCCCAGCCCCGAGCTGG + Exonic
1075334154 10:121597139-121597161 GAGGCTGGTGGTCCCCGAGCGGG + Intronic
1075726373 10:124612902-124612924 GCCCCTGGGGAGCCCAGAGCAGG + Intronic
1075885468 10:125896150-125896172 GGGGCGGGCGCGCCCCGAGCCGG - Intronic
1076156114 10:128206997-128207019 GCTGCTGGCCAGGCCTGAGCAGG + Intergenic
1076374312 10:129973084-129973106 GCGGCGGGCTAGGGCCGAGCGGG + Intergenic
1076880675 10:133237839-133237861 CCGCCTGGCGAGGCCCGAGGTGG + Exonic
1077041836 11:528263-528285 GCTGGTGGCGAGTCCTGAGCAGG + Intergenic
1079233630 11:18671360-18671382 GGGGCTGGAGGGCCCCGAGGAGG + Intergenic
1080503687 11:32892906-32892928 GCGGGCGGCGAGGCCCCAGCTGG - Intergenic
1083278156 11:61609119-61609141 CTGGCTGGCGAGCCCAGAGATGG + Intergenic
1083440315 11:62671899-62671921 GCGGGTGGAGAGCCCCGGACTGG + Intronic
1083572832 11:63769183-63769205 GCGGGTCGCGAGCTCCGTGCGGG + Intergenic
1083872472 11:65497643-65497665 GCGGCTCGCGAGCGCCGCGCAGG - Intergenic
1083886539 11:65576069-65576091 TCGGGTGGCGAGCGCGGAGCTGG - Exonic
1084183552 11:67458442-67458464 GCCGCTGGCGGGTCCTGAGCTGG + Exonic
1085295600 11:75430005-75430027 GCTGCTGGCGGACCCCGCGCTGG - Exonic
1085415122 11:76314563-76314585 AGGGCTGGGGAGCCCAGAGCAGG + Intergenic
1085530366 11:77189053-77189075 GCGGCTGCTGAGCCCAGAGCAGG + Intronic
1089243084 11:117098306-117098328 GCGGCTGGGGACCCCGGCGCGGG + Exonic
1090237559 11:125160599-125160621 GGGCCTGGCGATCCCAGAGCTGG + Intergenic
1092256344 12:6928346-6928368 ACGGCTGGCTGGCTCCGAGCGGG - Intronic
1092270332 12:7018507-7018529 GCCGTGGGCGGGCCCCGAGCCGG - Exonic
1092860629 12:12716901-12716923 GCCGCTGGGGAGGGCCGAGCTGG + Intronic
1094048594 12:26195428-26195450 GCGCCTGCCGGGCCCCGGGCAGG - Intronic
1102453324 12:113056982-113057004 GCCGCTCGCGGGCCCCCAGCGGG - Intronic
1103392483 12:120584623-120584645 GCGGCTGGCGCAGCCCGAGCCGG - Intergenic
1103727113 12:123003480-123003502 GTGGCTGGGGACTCCCGAGCTGG - Intronic
1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG + Intronic
1110318183 13:74134261-74134283 GCTGCCGGCGAGCCCCGGGGTGG + Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1113707698 13:112445162-112445184 CCGGCTAGTCAGCCCCGAGCCGG - Intergenic
1117690467 14:58299577-58299599 GCCGCTGGCGAGCTCCGGGGCGG + Intronic
1122741153 14:103872194-103872216 GCGGCAGGCAAGGCCCGGGCTGG - Intergenic
1202872590 14_GL000225v1_random:177767-177789 GGGGCGGGCGCGCCCCGAGCCGG + Intergenic
1123697271 15:22887928-22887950 ACGACTGGCGAGTCCAGAGCCGG - Intronic
1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG + Intergenic
1128280156 15:66387460-66387482 CCGGCTGGGGAGGCCCGAGCCGG + Intronic
1129675863 15:77632275-77632297 GCCGCGGCCGAGCCCCGAGCGGG - Intronic
1131827738 15:96333827-96333849 TCGGCGGACCAGCCCCGAGCGGG + Intronic
1132151925 15:99468015-99468037 GCAGCTGCAGAGCCCTGAGCTGG + Intergenic
1133738731 16:8635253-8635275 GATGCTAGCGAGCCCCGTGCCGG - Exonic
1133760881 16:8797581-8797603 GCGGGTGGCGAGCCTTGAGGGGG - Intronic
1137531968 16:49283434-49283456 GCTGCTGGCGATCCCAAAGCTGG - Intergenic
1137597666 16:49735542-49735564 GAGTCTGGCCAGCCCCGAGGGGG - Intronic
1142037363 16:87870052-87870074 GGGGCTGGTGAGCCGCGAACTGG + Intergenic
1142335799 16:89489527-89489549 GCGGCTCTCGGGCTCCGAGCCGG - Intronic
1145251493 17:21299142-21299164 GAGCTTGGCGAGCCCAGAGCTGG + Intronic
1147159394 17:38561660-38561682 GCGGCTGGGCGGCCCCGAGTAGG + Exonic
1147334140 17:39716610-39716632 GCTGCTGGCGGGCTCAGAGCTGG + Intronic
1151836441 17:76585658-76585680 GGGGCTGCCGAGCGCAGAGCGGG - Intronic
1152574614 17:81134560-81134582 GGGGCTGTGGAGCCCAGAGCAGG - Intronic
1152622613 17:81372835-81372857 GTGGCTGGGAAGGCCCGAGCTGG - Intergenic
1152801475 17:82332803-82332825 GCTGCTGCTGAGCCCAGAGCGGG - Intronic
1153480583 18:5543390-5543412 GCGGCTGGCGGGCCGCGGGAGGG - Intronic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154166108 18:12015574-12015596 GCTGCAGGAGAGCCCAGAGCAGG + Intronic
1155229283 18:23757366-23757388 GCTGCTGGAGAGCGCCAAGCAGG - Intronic
1157522574 18:48355557-48355579 CAGGCTGGGAAGCCCCGAGCAGG - Intronic
1160583263 18:79899675-79899697 GCGCGCGGCCAGCCCCGAGCCGG + Exonic
1160828590 19:1092016-1092038 GCGGAAGCCGAGGCCCGAGCAGG - Intronic
1160859043 19:1230009-1230031 GCGGGACGCGGGCCCCGAGCAGG - Exonic
1161215753 19:3094453-3094475 GCGGCTGGCGCGGCCCGAGCGGG + Exonic
1161337400 19:3721867-3721889 GGGGCTGGAGAGCCCCCAGGTGG + Exonic
1162293052 19:9793025-9793047 GCCGCTTCCGAGCCCCGAGAGGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1165080734 19:33304594-33304616 GGGGTTGGCGAACCCCGGGCCGG - Intergenic
1165110569 19:33499822-33499844 AGGGCTGGCCACCCCCGAGCTGG + Intronic
1166001115 19:39877955-39877977 GCAGCTGGCGAGCCCCAGGCTGG - Exonic
1166003900 19:39894214-39894236 GCAGCTGGCGAGCCCCAGGCTGG - Exonic
1166699835 19:44875892-44875914 GCGCCAGGCGAGCCCAGAGCGGG - Intronic
1166762653 19:45234596-45234618 GACGCTGGCGGGCCCCGGGCCGG - Intronic
1167258223 19:48443402-48443424 GGGGCTGGCGCGCCGGGAGCTGG + Exonic
1167414361 19:49362383-49362405 GGGGCTGGGGAGCCGCGGGCGGG + Intronic
1167472611 19:49684063-49684085 GTGGCTGGTGAGGCCCCAGCGGG + Exonic
1168080217 19:54004670-54004692 GAGGCTGGCGTGGCCGGAGCAGG - Intronic
1168240676 19:55087366-55087388 GCGGGCGGTGAGCCCCGAGGAGG + Exonic
925609267 2:5691110-5691132 GCGGCCGGGGAGCCGCGACCTGG - Intergenic
926092310 2:10058867-10058889 GCTGATGGCGAGCATCGAGCGGG - Exonic
927904881 2:26848866-26848888 GCGGCTGCCCAGCCCGGAGCGGG + Intronic
935971524 2:108534453-108534475 GCTACTGGCGGGCCCGGAGCAGG - Intronic
940775181 2:157876650-157876672 GCGGCGGGGCAGGCCCGAGCTGG + Intergenic
944159056 2:196639781-196639803 GAGGCTGCCGGGCCCCGGGCTGG + Intronic
947119520 2:226800149-226800171 GCGGCTACAGAGCCCCGAGTGGG + Intergenic
947807342 2:232977742-232977764 GGGCCTGGCAGGCCCCGAGCAGG + Intronic
948159466 2:235812310-235812332 GCGGCGGGCTTGCCCCGGGCAGG - Intronic
1172431900 20:34899169-34899191 GCGGAGGGAGAGGCCCGAGCGGG - Intronic
1173595626 20:44257155-44257177 GCGGCTGGTGATCGCCGAGAAGG + Exonic
1175859565 20:62143140-62143162 GGGGCTGGGGAGCCCAGAGAGGG - Intronic
1178203072 21:30430436-30430458 GCAGCTGGCGGGCTCCCAGCAGG - Exonic
1180285511 22:10741709-10741731 GGGGCGAGCGCGCCCCGAGCCGG - Intergenic
1180702435 22:17788942-17788964 GCGGCTGGAGCGCCCCTGGCAGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181085208 22:20436640-20436662 GCGGCCGCCGGGCTCCGAGCTGG - Intronic
1184877537 22:47285002-47285024 GCAGCTGGTGAGCTCAGAGCCGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950487482 3:13282009-13282031 CCGGCTGGCGGGCTGCGAGCCGG + Intergenic
950631521 3:14285168-14285190 GCCACTGGCGAGCCCTGGGCAGG - Intergenic
951803893 3:26624633-26624655 GAGGCTGGGGAGCGCAGAGCTGG + Intronic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
955239329 3:57165334-57165356 GCCGCTGGCCAGCCCCGAGTGGG + Exonic
956167083 3:66405206-66405228 GAGGCTGTCGAGCCCTGAGAAGG + Exonic
963061741 3:141231847-141231869 GCTGGCGGCGAGCGCCGAGCCGG + Exonic
968597509 4:1493036-1493058 CTGCCTGGCGAGCCCCCAGCTGG - Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
968974204 4:3812550-3812572 GTGGCTGCCGAACCCCGACCAGG - Intergenic
969714488 4:8861665-8861687 GCGGTTGGCGAAACCCGAGGAGG + Intronic
989638116 5:43557185-43557207 GCGGCCGGCCAGCCGCGAACTGG - Intronic
991676541 5:69094237-69094259 GCGGCTCGTGAGCCCCGGGATGG + Exonic
992400046 5:76403505-76403527 GCGGGGGGCGCGCCCCGGGCGGG + Exonic
996405356 5:123098404-123098426 GCGGATGGCCTGCCCCGAGAAGG - Intronic
998997101 5:147877657-147877679 GTGGCCGGGGAGCCCTGAGCTGG + Intronic
999201555 5:149820374-149820396 GAGGCTGGCTAGACCCAAGCAGG - Intronic
1001191613 5:169637409-169637431 GTGGCGGGAGAGCCGCGAGCAGG + Intronic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002612736 5:180432112-180432134 TGGGCTGGCGAGGCCGGAGCCGG + Intergenic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1007406456 6:41638593-41638615 GCGCATGGCGGGCCCCGCGCGGG + Exonic
1011426741 6:87239376-87239398 GCGGCTGGCGGGCCGGGGGCTGG + Intronic
1017834900 6:158168273-158168295 GCGGGAGGCGGGCCCAGAGCGGG - Intergenic
1018717021 6:166541264-166541286 GGGGCAGGCGAGGCACGAGCTGG + Intronic
1019342999 7:517326-517348 GCGGCCTGTGCGCCCCGAGCTGG - Intronic
1019427519 7:984498-984520 GGCGCTGGCGGGCCCCGGGCAGG + Exonic
1019572466 7:1719425-1719447 GGGGCTGCCTAGCCCAGAGCCGG - Intronic
1019722819 7:2583732-2583754 GCGGAGGGCGGGCACCGAGCTGG + Intronic
1019722831 7:2583763-2583785 GCGGAGGGCGGGCACCGAGCTGG + Intronic
1019738072 7:2660210-2660232 GAGGCTGGCGGGCCCAGAGCCGG - Intronic
1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG + Exonic
1023049164 7:36236241-36236263 GGGGCTGGCGAGGCCGGAGCCGG + Intronic
1026883526 7:73922242-73922264 GCTGCTGGCGAGCCCGATGCTGG + Intergenic
1029110901 7:98212537-98212559 GCGGCTGGAGAGCAACGAGAGGG + Exonic
1032160080 7:129502988-129503010 GCGGCTGCTGCGCCCCCAGCAGG - Intronic
1034335961 7:150323599-150323621 GCGGCTGTCGGGGCCCGTGCCGG + Intronic
1034445960 7:151114606-151114628 GCGGCCGGCAAGCCCAGACCTGG - Intronic
1035022880 7:155809394-155809416 GCGGCAGGGGAGCCCCAGGCCGG - Intronic
1035360543 7:158310655-158310677 ACGGAGGGCGAGCCCTGAGCCGG + Intronic
1035360552 7:158310694-158310716 ACGGAGGGCGAGCCCTGAGCCGG + Intronic
1035360570 7:158310772-158310794 ACGGAGGGCGAGCCCTGAGCCGG + Intronic
1035360579 7:158310811-158310833 ACGGAGGGCGAGCCCTGAGCCGG + Intronic
1036739288 8:11347045-11347067 GGGGCTCGCGCGCCCCCAGCGGG - Intergenic
1037788951 8:21919872-21919894 GGGCCTGCCGAGTCCCGAGCCGG - Intronic
1038632810 8:29262567-29262589 GGGGCTGGCGACCCGCGCGCGGG + Intronic
1040386424 8:46917830-46917852 GCGCCTGGCGCGCCCCCTGCTGG - Intergenic
1041166950 8:55101266-55101288 GCGGCTGGAAAGCTCTGAGCCGG - Intergenic
1049102394 8:140589057-140589079 GCGGCAGGCGAGCCTCCTGCAGG + Intronic
1049381683 8:142319462-142319484 GGGGGTGGCGAACCCCAAGCGGG - Intronic
1049818301 8:144618780-144618802 GGGGCTGGGGAGGCCCCAGCAGG - Intergenic
1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG + Exonic
1057227606 9:93300777-93300799 GGGGCTGGGGAGGCCCGAACTGG - Intronic
1060423116 9:123483538-123483560 GCGTCTGGTCAGCCCAGAGCTGG - Intronic
1060775083 9:126367227-126367249 GTGGCTGGAGAGCCCCGGGCAGG - Intronic
1061587715 9:131579361-131579383 GAGGCTGGCCAGCCCTCAGCGGG - Exonic
1061912507 9:133732521-133732543 GCGGGTGGTGAGCCGGGAGCTGG - Exonic
1062421071 9:136483039-136483061 GCGGCCGCGGAGACCCGAGCCGG - Intronic
1203731865 Un_GL000216v2:98775-98797 GGGGCGGGCGCGCCTCGAGCCGG - Intergenic
1185890234 X:3816083-3816105 GCGGCTCTCGGGCTCCGAGCCGG + Intergenic
1194077670 X:89417077-89417099 GGGACTGGCGAGGCCAGAGCCGG + Intergenic
1195156063 X:102125738-102125760 GCGGCGGGGGAGCAGCGAGCGGG + Exonic
1195158053 X:102142399-102142421 GCGGCGGGGGAGCAGCGAGCGGG - Exonic
1200430321 Y:3072623-3072645 GGGACTGGCGAGTCCAGAGCCGG + Intergenic