ID: 1110120871

View in Genome Browser
Species Human (GRCh38)
Location 13:71879996-71880018
Sequence CTATTTCACCAGATCTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110120868_1110120871 22 Left 1110120868 13:71879951-71879973 CCGTAAGAAATTGCTTTTGTTAG No data
Right 1110120871 13:71879996-71880018 CTATTTCACCAGATCTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110120871 Original CRISPR CTATTTCACCAGATCTCTTG GGG Intergenic
No off target data available for this crispr