ID: 1110122905

View in Genome Browser
Species Human (GRCh38)
Location 13:71905362-71905384
Sequence CCTTAGGAGGAGAGGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110122905_1110122910 -5 Left 1110122905 13:71905362-71905384 CCTTTCTTCCTCTCCTCCTAAGG No data
Right 1110122910 13:71905380-71905402 TAAGGCCTCCTCCACCACCTTGG No data
1110122905_1110122916 14 Left 1110122905 13:71905362-71905384 CCTTTCTTCCTCTCCTCCTAAGG No data
Right 1110122916 13:71905399-71905421 TTGGAATAAACCGCCTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110122905 Original CRISPR CCTTAGGAGGAGAGGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr