ID: 1110123545

View in Genome Browser
Species Human (GRCh38)
Location 13:71913017-71913039
Sequence CTTTGAGTGGAGAGGTACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110123545_1110123550 -1 Left 1110123545 13:71913017-71913039 CCCACGTACCTCTCCACTCAAAG No data
Right 1110123550 13:71913039-71913061 GAGAGAAATGCTTGGTACTGTGG No data
1110123545_1110123549 -9 Left 1110123545 13:71913017-71913039 CCCACGTACCTCTCCACTCAAAG No data
Right 1110123549 13:71913031-71913053 CACTCAAAGAGAGAAATGCTTGG No data
1110123545_1110123551 0 Left 1110123545 13:71913017-71913039 CCCACGTACCTCTCCACTCAAAG No data
Right 1110123551 13:71913040-71913062 AGAGAAATGCTTGGTACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110123545 Original CRISPR CTTTGAGTGGAGAGGTACGT GGG (reversed) Intergenic
No off target data available for this crispr