ID: 1110124999

View in Genome Browser
Species Human (GRCh38)
Location 13:71931678-71931700
Sequence GACTCACAGTTCCCCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22190
Summary {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110124999_1110125004 16 Left 1110124999 13:71931678-71931700 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1110125004 13:71931717-71931739 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110124999 Original CRISPR GACTCACAGTTCCCCAGGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr