ID: 1110125004

View in Genome Browser
Species Human (GRCh38)
Location 13:71931717-71931739
Sequence TTTATAAATTACCCAGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51796
Summary {0: 6401, 1: 13084, 2: 14111, 3: 11019, 4: 7181}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110124998_1110125004 17 Left 1110124998 13:71931677-71931699 CCCAGCCCTGGGGAACTGTGAGT 0: 7
1: 282
2: 4254
3: 9482
4: 9076
Right 1110125004 13:71931717-71931739 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
1110124997_1110125004 18 Left 1110124997 13:71931676-71931698 CCCCAGCCCTGGGGAACTGTGAG 0: 7
1: 261
2: 4036
3: 9123
4: 9341
Right 1110125004 13:71931717-71931739 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
1110124996_1110125004 21 Left 1110124996 13:71931673-71931695 CCTCCCCAGCCCTGGGGAACTGT 0: 5
1: 228
2: 4906
3: 8932
4: 8764
Right 1110125004 13:71931717-71931739 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
1110124999_1110125004 16 Left 1110124999 13:71931678-71931700 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1110125004 13:71931717-71931739 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
1110124993_1110125004 28 Left 1110124993 13:71931666-71931688 CCTGAGGCCTCCCCAGCCCTGGG No data
Right 1110125004 13:71931717-71931739 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
1110125000_1110125004 12 Left 1110125000 13:71931682-71931704 CCCTGGGGAACTGTGAGTCAACT No data
Right 1110125004 13:71931717-71931739 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
1110125001_1110125004 11 Left 1110125001 13:71931683-71931705 CCTGGGGAACTGTGAGTCAACTA No data
Right 1110125004 13:71931717-71931739 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110125004 Original CRISPR TTTATAAATTACCCAGTCTC AGG Intergenic
Too many off-targets to display for this crispr