ID: 1110125264

View in Genome Browser
Species Human (GRCh38)
Location 13:71934262-71934284
Sequence GGCCAAACAGTAGTGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110125259_1110125264 2 Left 1110125259 13:71934237-71934259 CCTGGAGAACACAGGGGAAAGTG No data
Right 1110125264 13:71934262-71934284 GGCCAAACAGTAGTGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110125264 Original CRISPR GGCCAAACAGTAGTGGTGGG AGG Intergenic
No off target data available for this crispr