ID: 1110127497

View in Genome Browser
Species Human (GRCh38)
Location 13:71964758-71964780
Sequence TGAAGGGGCAGGTATAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110127497_1110127505 28 Left 1110127497 13:71964758-71964780 CCTCCTCTATACCTGCCCCTTCA No data
Right 1110127505 13:71964809-71964831 ACACAGCTTTCCTGGATATTAGG No data
1110127497_1110127506 29 Left 1110127497 13:71964758-71964780 CCTCCTCTATACCTGCCCCTTCA No data
Right 1110127506 13:71964810-71964832 CACAGCTTTCCTGGATATTAGGG No data
1110127497_1110127503 20 Left 1110127497 13:71964758-71964780 CCTCCTCTATACCTGCCCCTTCA No data
Right 1110127503 13:71964801-71964823 TGCCTGAGACACAGCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110127497 Original CRISPR TGAAGGGGCAGGTATAGAGG AGG (reversed) Intergenic
No off target data available for this crispr