ID: 1110127505

View in Genome Browser
Species Human (GRCh38)
Location 13:71964809-71964831
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110127498_1110127505 25 Left 1110127498 13:71964761-71964783 CCTCTATACCTGCCCCTTCACAA No data
Right 1110127505 13:71964809-71964831 ACACAGCTTTCCTGGATATTAGG No data
1110127500_1110127505 13 Left 1110127500 13:71964773-71964795 CCCCTTCACAAGATCAAGAGCAC No data
Right 1110127505 13:71964809-71964831 ACACAGCTTTCCTGGATATTAGG No data
1110127502_1110127505 11 Left 1110127502 13:71964775-71964797 CCTTCACAAGATCAAGAGCACAG No data
Right 1110127505 13:71964809-71964831 ACACAGCTTTCCTGGATATTAGG No data
1110127497_1110127505 28 Left 1110127497 13:71964758-71964780 CCTCCTCTATACCTGCCCCTTCA No data
Right 1110127505 13:71964809-71964831 ACACAGCTTTCCTGGATATTAGG No data
1110127499_1110127505 17 Left 1110127499 13:71964769-71964791 CCTGCCCCTTCACAAGATCAAGA No data
Right 1110127505 13:71964809-71964831 ACACAGCTTTCCTGGATATTAGG No data
1110127501_1110127505 12 Left 1110127501 13:71964774-71964796 CCCTTCACAAGATCAAGAGCACA No data
Right 1110127505 13:71964809-71964831 ACACAGCTTTCCTGGATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110127505 Original CRISPR ACACAGCTTTCCTGGATATT AGG Intergenic
No off target data available for this crispr