ID: 1110127506

View in Genome Browser
Species Human (GRCh38)
Location 13:71964810-71964832
Sequence CACAGCTTTCCTGGATATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110127500_1110127506 14 Left 1110127500 13:71964773-71964795 CCCCTTCACAAGATCAAGAGCAC No data
Right 1110127506 13:71964810-71964832 CACAGCTTTCCTGGATATTAGGG No data
1110127502_1110127506 12 Left 1110127502 13:71964775-71964797 CCTTCACAAGATCAAGAGCACAG No data
Right 1110127506 13:71964810-71964832 CACAGCTTTCCTGGATATTAGGG No data
1110127497_1110127506 29 Left 1110127497 13:71964758-71964780 CCTCCTCTATACCTGCCCCTTCA No data
Right 1110127506 13:71964810-71964832 CACAGCTTTCCTGGATATTAGGG No data
1110127499_1110127506 18 Left 1110127499 13:71964769-71964791 CCTGCCCCTTCACAAGATCAAGA No data
Right 1110127506 13:71964810-71964832 CACAGCTTTCCTGGATATTAGGG No data
1110127498_1110127506 26 Left 1110127498 13:71964761-71964783 CCTCTATACCTGCCCCTTCACAA No data
Right 1110127506 13:71964810-71964832 CACAGCTTTCCTGGATATTAGGG No data
1110127501_1110127506 13 Left 1110127501 13:71964774-71964796 CCCTTCACAAGATCAAGAGCACA No data
Right 1110127506 13:71964810-71964832 CACAGCTTTCCTGGATATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110127506 Original CRISPR CACAGCTTTCCTGGATATTA GGG Intergenic
No off target data available for this crispr