ID: 1110136504

View in Genome Browser
Species Human (GRCh38)
Location 13:72073777-72073799
Sequence CTGTATCCTCACATGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110136504_1110136508 12 Left 1110136504 13:72073777-72073799 CCCGCTTCCATGTGAGGATACAG No data
Right 1110136508 13:72073812-72073834 CATCTACAAGCTAGGAAAAGAGG No data
1110136504_1110136507 4 Left 1110136504 13:72073777-72073799 CCCGCTTCCATGTGAGGATACAG No data
Right 1110136507 13:72073804-72073826 AAGATAGACATCTACAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110136504 Original CRISPR CTGTATCCTCACATGGAAGC GGG (reversed) Intergenic
No off target data available for this crispr