ID: 1110137159

View in Genome Browser
Species Human (GRCh38)
Location 13:72082128-72082150
Sequence GAGGAATGACACAGATTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110137159_1110137165 20 Left 1110137159 13:72082128-72082150 CCCCAGAATCTGTGTCATTCCTC No data
Right 1110137165 13:72082171-72082193 TTCTTCTAATTCTTCTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110137159 Original CRISPR GAGGAATGACACAGATTCTG GGG (reversed) Intergenic