ID: 1110138689

View in Genome Browser
Species Human (GRCh38)
Location 13:72101013-72101035
Sequence TGGTTGGGATTGGAGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110138689_1110138695 -5 Left 1110138689 13:72101013-72101035 CCTGGGGCCTCCAATCCCAACCA No data
Right 1110138695 13:72101031-72101053 AACCATCTGTAAACAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110138689 Original CRISPR TGGTTGGGATTGGAGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr