ID: 1110139469

View in Genome Browser
Species Human (GRCh38)
Location 13:72110047-72110069
Sequence TTTTCTCTCCAGAAGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110139469_1110139472 27 Left 1110139469 13:72110047-72110069 CCTGTCATCTTCTGGAGAGAAAA No data
Right 1110139472 13:72110097-72110119 ATGGATCTATGTGAGACACAAGG No data
1110139469_1110139471 8 Left 1110139469 13:72110047-72110069 CCTGTCATCTTCTGGAGAGAAAA No data
Right 1110139471 13:72110078-72110100 CAGAAGAAAATGTTTTTATATGG No data
1110139469_1110139473 28 Left 1110139469 13:72110047-72110069 CCTGTCATCTTCTGGAGAGAAAA No data
Right 1110139473 13:72110098-72110120 TGGATCTATGTGAGACACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110139469 Original CRISPR TTTTCTCTCCAGAAGATGAC AGG (reversed) Intergenic
No off target data available for this crispr