ID: 1110141139

View in Genome Browser
Species Human (GRCh38)
Location 13:72131002-72131024
Sequence TAGAATAAGCATAATAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110141134_1110141139 20 Left 1110141134 13:72130959-72130981 CCAGGGAAAGATGACAGAAAGTG No data
Right 1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110141139 Original CRISPR TAGAATAAGCATAATAAGGA AGG Intergenic
No off target data available for this crispr