ID: 1110142280

View in Genome Browser
Species Human (GRCh38)
Location 13:72145229-72145251
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110142278_1110142280 17 Left 1110142278 13:72145189-72145211 CCAAGAAGTATCAAAAGACTCAT No data
Right 1110142280 13:72145229-72145251 TAGCTCTACAACTGACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110142280 Original CRISPR TAGCTCTACAACTGACAGTG AGG Intergenic
No off target data available for this crispr