ID: 1110146640

View in Genome Browser
Species Human (GRCh38)
Location 13:72199978-72200000
Sequence CTGCTGTTTTTGAAAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110146640_1110146643 29 Left 1110146640 13:72199978-72200000 CCTTTGTTTTTCAAAAACAGCAG No data
Right 1110146643 13:72200030-72200052 GCATCGATTATATTTTCTGATGG No data
1110146640_1110146642 -1 Left 1110146640 13:72199978-72200000 CCTTTGTTTTTCAAAAACAGCAG No data
Right 1110146642 13:72200000-72200022 GGAGATAGTGTTTGCATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110146640 Original CRISPR CTGCTGTTTTTGAAAAACAA AGG (reversed) Intergenic
No off target data available for this crispr