ID: 1110151431

View in Genome Browser
Species Human (GRCh38)
Location 13:72259577-72259599
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110151430_1110151431 -4 Left 1110151430 13:72259558-72259580 CCATTTTGAATATTAGAAAGATC No data
Right 1110151431 13:72259577-72259599 GATCCCTCCAGCAGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110151431 Original CRISPR GATCCCTCCAGCAGTGAGAA AGG Intergenic
No off target data available for this crispr