ID: 1110151441

View in Genome Browser
Species Human (GRCh38)
Location 13:72259615-72259637
Sequence GTGTAAGACCAGATACTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110151436_1110151441 8 Left 1110151436 13:72259584-72259606 CCAGCAGTGAGAAAGGGAGTGGA No data
Right 1110151441 13:72259615-72259637 GTGTAAGACCAGATACTTGGAGG No data
1110151433_1110151441 12 Left 1110151433 13:72259580-72259602 CCCTCCAGCAGTGAGAAAGGGAG No data
Right 1110151441 13:72259615-72259637 GTGTAAGACCAGATACTTGGAGG No data
1110151434_1110151441 11 Left 1110151434 13:72259581-72259603 CCTCCAGCAGTGAGAAAGGGAGT No data
Right 1110151441 13:72259615-72259637 GTGTAAGACCAGATACTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110151441 Original CRISPR GTGTAAGACCAGATACTTGG AGG Intergenic
No off target data available for this crispr