ID: 1110155625

View in Genome Browser
Species Human (GRCh38)
Location 13:72313355-72313377
Sequence CTTTCTTTTGGGGAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110155625_1110155631 1 Left 1110155625 13:72313355-72313377 CCTTCCATCTCCCCAAAAGAAAG No data
Right 1110155631 13:72313379-72313401 AGAGTCTAATTTCTCTCCCCTGG No data
1110155625_1110155632 8 Left 1110155625 13:72313355-72313377 CCTTCCATCTCCCCAAAAGAAAG No data
Right 1110155632 13:72313386-72313408 AATTTCTCTCCCCTGGATTATGG No data
1110155625_1110155633 9 Left 1110155625 13:72313355-72313377 CCTTCCATCTCCCCAAAAGAAAG No data
Right 1110155633 13:72313387-72313409 ATTTCTCTCCCCTGGATTATGGG No data
1110155625_1110155634 13 Left 1110155625 13:72313355-72313377 CCTTCCATCTCCCCAAAAGAAAG No data
Right 1110155634 13:72313391-72313413 CTCTCCCCTGGATTATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110155625 Original CRISPR CTTTCTTTTGGGGAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr