ID: 1110156457

View in Genome Browser
Species Human (GRCh38)
Location 13:72322584-72322606
Sequence GTGAGATTGTCTATTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110156457_1110156459 1 Left 1110156457 13:72322584-72322606 CCCATGGAAATAGACAATCTCAC No data
Right 1110156459 13:72322608-72322630 GTCCCACTCCCTCTTCCAACAGG No data
1110156457_1110156465 17 Left 1110156457 13:72322584-72322606 CCCATGGAAATAGACAATCTCAC No data
Right 1110156465 13:72322624-72322646 CAACAGGTACAAATCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110156457 Original CRISPR GTGAGATTGTCTATTTCCAT GGG (reversed) Intergenic
No off target data available for this crispr