ID: 1110156459

View in Genome Browser
Species Human (GRCh38)
Location 13:72322608-72322630
Sequence GTCCCACTCCCTCTTCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110156456_1110156459 4 Left 1110156456 13:72322581-72322603 CCTCCCATGGAAATAGACAATCT No data
Right 1110156459 13:72322608-72322630 GTCCCACTCCCTCTTCCAACAGG No data
1110156457_1110156459 1 Left 1110156457 13:72322584-72322606 CCCATGGAAATAGACAATCTCAC No data
Right 1110156459 13:72322608-72322630 GTCCCACTCCCTCTTCCAACAGG No data
1110156458_1110156459 0 Left 1110156458 13:72322585-72322607 CCATGGAAATAGACAATCTCACT No data
Right 1110156459 13:72322608-72322630 GTCCCACTCCCTCTTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110156459 Original CRISPR GTCCCACTCCCTCTTCCAAC AGG Intergenic
No off target data available for this crispr