ID: 1110156465

View in Genome Browser
Species Human (GRCh38)
Location 13:72322624-72322646
Sequence CAACAGGTACAAATCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110156457_1110156465 17 Left 1110156457 13:72322584-72322606 CCCATGGAAATAGACAATCTCAC No data
Right 1110156465 13:72322624-72322646 CAACAGGTACAAATCCTCAGTGG No data
1110156456_1110156465 20 Left 1110156456 13:72322581-72322603 CCTCCCATGGAAATAGACAATCT No data
Right 1110156465 13:72322624-72322646 CAACAGGTACAAATCCTCAGTGG No data
1110156458_1110156465 16 Left 1110156458 13:72322585-72322607 CCATGGAAATAGACAATCTCACT No data
Right 1110156465 13:72322624-72322646 CAACAGGTACAAATCCTCAGTGG No data
1110156460_1110156465 -9 Left 1110156460 13:72322610-72322632 CCCACTCCCTCTTCCAACAGGTA No data
Right 1110156465 13:72322624-72322646 CAACAGGTACAAATCCTCAGTGG No data
1110156461_1110156465 -10 Left 1110156461 13:72322611-72322633 CCACTCCCTCTTCCAACAGGTAC No data
Right 1110156465 13:72322624-72322646 CAACAGGTACAAATCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110156465 Original CRISPR CAACAGGTACAAATCCTCAG TGG Intergenic
No off target data available for this crispr