ID: 1110156790

View in Genome Browser
Species Human (GRCh38)
Location 13:72326456-72326478
Sequence CTACATATGAGACTTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110156785_1110156790 2 Left 1110156785 13:72326431-72326453 CCATGACATATGGGAATTGTGAG No data
Right 1110156790 13:72326456-72326478 CTACATATGAGACTTGGGTGGGG No data
1110156779_1110156790 16 Left 1110156779 13:72326417-72326439 CCACTGGGTCCCTCCCATGACAT 0: 252
1: 843
2: 2228
3: 4473
4: 6055
Right 1110156790 13:72326456-72326478 CTACATATGAGACTTGGGTGGGG No data
1110156784_1110156790 3 Left 1110156784 13:72326430-72326452 CCCATGACATATGGGAATTGTGA No data
Right 1110156790 13:72326456-72326478 CTACATATGAGACTTGGGTGGGG No data
1110156783_1110156790 6 Left 1110156783 13:72326427-72326449 CCTCCCATGACATATGGGAATTG 0: 7
1: 301
2: 941
3: 2680
4: 7108
Right 1110156790 13:72326456-72326478 CTACATATGAGACTTGGGTGGGG No data
1110156782_1110156790 7 Left 1110156782 13:72326426-72326448 CCCTCCCATGACATATGGGAATT 0: 19
1: 474
2: 2010
3: 6004
4: 8125
Right 1110156790 13:72326456-72326478 CTACATATGAGACTTGGGTGGGG No data
1110156777_1110156790 20 Left 1110156777 13:72326413-72326435 CCTCCCACTGGGTCCCTCCCATG 0: 530
1: 1103
2: 2381
3: 3775
4: 4654
Right 1110156790 13:72326456-72326478 CTACATATGAGACTTGGGTGGGG No data
1110156778_1110156790 17 Left 1110156778 13:72326416-72326438 CCCACTGGGTCCCTCCCATGACA 0: 579
1: 1302
2: 3253
3: 5050
4: 6076
Right 1110156790 13:72326456-72326478 CTACATATGAGACTTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110156790 Original CRISPR CTACATATGAGACTTGGGTG GGG Intergenic
No off target data available for this crispr