ID: 1110157023

View in Genome Browser
Species Human (GRCh38)
Location 13:72329822-72329844
Sequence AACCTACCAGTGCTTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110157023_1110157027 16 Left 1110157023 13:72329822-72329844 CCAAGCTCAAGCACTGGTAGGTT No data
Right 1110157027 13:72329861-72329883 TCCGGTCTCTGCTTCCAAAATGG No data
1110157023_1110157024 -8 Left 1110157023 13:72329822-72329844 CCAAGCTCAAGCACTGGTAGGTT No data
Right 1110157024 13:72329837-72329859 GGTAGGTTTGTTGTCTGTTGAGG No data
1110157023_1110157025 -7 Left 1110157023 13:72329822-72329844 CCAAGCTCAAGCACTGGTAGGTT No data
Right 1110157025 13:72329838-72329860 GTAGGTTTGTTGTCTGTTGAGGG No data
1110157023_1110157026 -2 Left 1110157023 13:72329822-72329844 CCAAGCTCAAGCACTGGTAGGTT No data
Right 1110157026 13:72329843-72329865 TTTGTTGTCTGTTGAGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110157023 Original CRISPR AACCTACCAGTGCTTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr