ID: 1110157027

View in Genome Browser
Species Human (GRCh38)
Location 13:72329861-72329883
Sequence TCCGGTCTCTGCTTCCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110157023_1110157027 16 Left 1110157023 13:72329822-72329844 CCAAGCTCAAGCACTGGTAGGTT No data
Right 1110157027 13:72329861-72329883 TCCGGTCTCTGCTTCCAAAATGG No data
1110157020_1110157027 24 Left 1110157020 13:72329814-72329836 CCGAAAGTCCAAGCTCAAGCACT No data
Right 1110157027 13:72329861-72329883 TCCGGTCTCTGCTTCCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110157027 Original CRISPR TCCGGTCTCTGCTTCCAAAA TGG Intergenic
No off target data available for this crispr